Labshake search
Citations for Roche :
1751 - 1800 of 2352 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Live/dead cell exclusion was performed with DAPI (4′-phenylindole dihydrochloride; Roche) or LIVE/dead fixable dye (Thermofisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and incubated with 4 μl of DIG-Prime kit (Roche, Mannheim, Germany), overnight at 37°C ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... overnight at 4 °C in presence of protease inhibitor cocktail (Roche, Switzerland). The beads were washed with buffer W ...
-
bioRxiv - Developmental Biology 2024Quote: ... then incubated overnight at 4°C with anti-DIG antibody (11093274910, Roche) at 1:5000 in blocking buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 mM DTT) supplemented with 2x Complete EDTA free protease inhibitor (Roche). Samples were spun at 30,000 g for 10 min at 4°C and the cleared lysate was incubated with 40 µl anti-FLAG agarose bead slurry (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... proteinase K (4 µg/ml; F. Hoffmann La Roche Ltd, 211 Switzerland) and by heating at 96°C for 20 min in EnVisionTM FLEX Target Retrieval solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... were incorporated by PCR (4 cycles) using KAPA HiFi Hotstart ReadyMix (Roche).
-
bioRxiv - Genomics 2023Quote: ... 4 μL of Lysis mix (Proteinase K (5.05 mg/mL, Roche, 3115879001), IGEPAL CA-630 (5.05% ...
-
bioRxiv - Microbiology 2023Quote: ... 250 μL lysis buffer (4% w/v SDS and cOmplete Tablets (Roche) in 50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Molecular Biology 2024Quote: ... constructs in 6:3:1 weight ratios by X-Treme Gene HP Transfection Reagent (Roche) or the calcium phosphate method ...
-
bioRxiv - Developmental Biology 2022Quote: ... AP reaction was developed with 4-Nitro blue tetrazolium chloride (NBT, Roche, 11383213001) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 µg recombinant NAA50 was incubated with 100 µM Acetyl-Coenzyme A (Roche) in a 2X acetylation buffer (50mM Tris HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 mg DNase and one Complete Protease Inhibitor Cocktail Tablet (Roche Diagnostics GmbH). Cells were lysed by the addition of 1% v/w n-dodecyl-β-D-maltopyranoside (DDM ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 4-minute digestion with proteinase K (Roche, 1:1000 in PBS-DEPC) is followed by probe titration (100-300 ng per slide dependent on the probe ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then blocked overnight at 4°C in 1 % blocking reagent (Roche) plus 5 % sheep serum in MAB and incubated with anti-DIG conjugated to Peroxidase (1/50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized by adding 4 units of AMV reverse transcriptase enzyme (Roche) and 0.5 μl 20 pmol/μl of reverse primer labeled with [32P] per reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... 1ml of digestion solution (TM Liberase at 4 units/mL (Roche, Basel, Switzerland) and DNAse Type I at 800 units/mL (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 200 μl/ml of a 4% stock solution of blocking reagent (Roche 11096176001) which was dissolved and autoclaved in MNT solution (150 mM maleic acid pH 7.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Developmental Biology 2024Quote: ... AP reaction was developed with 4-Nitro blue tetrazolium chloride (NBT, Roche, 11383213001) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were fixed with PFA 4 % and stained with DAPI (Roche; 1:10,000) for 5 min ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Cell Biology 2022Quote: ... MEFs were incubated for 4 h with 10 ng/ml colcemid (Roche, 10295892001). Cells were then collected and incubated for 15 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 mM EDTA) supplemented with cOmplete Mini EDTA-free protease inhibitor cocktail (Roche). Proteins were resolved on a 4%–12% bis-tris gel (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 4 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 mM Sodium Orthovanadate and supplemented with protease inhibitors (Complete protease inhibitors, Roche). After a 20min incubation on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... 40 µl of beads underwent RNase digestion [4 μl RNase A (10109169001; Roche), 1 mg/ml ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...