Labshake search
Citations for Roche :
1551 - 1600 of 2352 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science, Mannheim, Germany) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cancer Biology 2023Quote: ... Fractions were supplemented with SDS (to a final concentration of 1%) and then digested with proteinase K (Roche, final concentration of 2 µg/ml) for 45 min at 42 C ...
-
bioRxiv - Biochemistry 2024Quote: ... 250 mg of powder was thawed at 4°C followed by resuspension in 1 mL of HIP buffer (40 mM HEPES-KOH pH 7.5, 110 mM KOAc, 2 mM MgCl2, 1% Triton X-100, 0.1% Tween, 1x protease inhibitor cocktail [Roche], 1% solution P, 1 mM DTT). The lysate was next passed through a Whatman 25 mm GD/X Disposable filter (Cat No ...
-
bioRxiv - Biochemistry 2023Quote: ... and were resuspended in 30 mL lysis buffer 1 (50 mM sodium phosphate, 300 mM NaCl, pH 8) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension three times through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Cell Biology 2024Quote: ... a final concentration of 1 ng/μl cDNA was mixed with 2 μl FastStart DNA Master SYBR Green I (Roche #03 003 230 001), 0.5 μM forward and reverse primer ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Genetics 2024Quote: ... 30 mM Tris-HCl, 20 mM KCl, 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 150 mM NaCl, cOmplete proteinase inhibitor [Roche Diagnostics, Indianapolis, IN, USA]), lysed by ultrasonic treatment and incubated with EZview anti-HA agarose beads (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Microbiology 2020Quote: ... NimbleGen 4-plex arrays containing 4 × 72,000 arrays per slide were used (Roche, Mannheim, Germany). Construction of this chip was initially based on combining two previous genome annotations (Amselem et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg of plasmid and 4 μl of X-tremeGENE HP DNA Transfection Reagent (Roche) were used per well ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 tetrazolium]-bis(4-methoxy-6-nitro)-benzene sulfonic acid hydrate (XTT)-based colorimetric assay (Roche) according to manufacturer-recommended protocols ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR was performed using the extracted DNA (100 ng) as template with Kapa SYBR Fast qPCR Kit Master Mix (2×) Universal (Kapa Biosystems Ltd., Wilmington, MA, USA) on a CFX connect real-time system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 mM NaCl, 1 mM MgCl2, 10 mM Imidazole, 0.5% IGEPAL® CA-630, 2 mM β-Mercapto-ethanol supplemented with Roche cOmplete inhibitor cocktail tablets) at a ratio of 15 ml of buffer/g of biomass ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5X SSC, 5X Denhardt’s solution, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water). Incubation with pre-hybridization buffer was carried out during 4h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50% formamide, 5X SSC, 5X Denhardt’s, 200 μg/ml yeast RNA, 500 μg/ml salmon sperm DNA and 2% Roche blocking reagent in DEPC treated water) containing biotin and/or digoxin labeled Locked Nucleic Acid (LNATM ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were then thawed and resuspended in 1 ml lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 0.5 mg/ml lysozyme, 2 mM EDTA and one Roche protease inhibitor tablet per 10 ml). Complete lysis was achieved after a 15-min incubation at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pellet from a 2 L culture was resuspended in 100 mL lysis buffer (20 mM Tris-HCl pH 7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10 % glycerol, protease inhibitor cocktail (Roche, as directed by the manufacturer), 20 mM imidazole) ...
-
bioRxiv - Plant Biology 2024Quote: ... 15 mM MgCl2, 1 mM EDTA, 10 % glycerol, 1 % Triton X-100, 10 mM β-mercaptoethanol, 2 mM PMSF and Roche cOmplete Protease Inhibitor Cocktail)) were added in the ground leaves and incubated for 30 min at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µl of 1x Lysis Buffer were added (20 mM Tris-HCl pH8, 150 mM NaCl, 2 mM EDTA, 1x Protease Inhibitor Roche, #04693116001, 1% NP40 Sigma, #I8896), the embryos were smashed by pipetting up and down several times and the samples were centrifuged at 4 °C at maximum speed for 15 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mg/mL DNAase (Roche, 04716728001). The cells were resuspended by mechanical agitation through Pasteur pipettes flamed with decreasing diameters ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2024Quote: ... knee cartilage was harvested from postnatal day 3-5 mice and treated with 3 mg/ml collagenase D (11088866001, Roche) in DMEM (10569010 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...