Labshake search
Citations for Roche :
1701 - 1750 of 7686 citations for rno mir 16 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.
-
bioRxiv - Microbiology 2023Quote: ... and PCR products were purified using the DNeasy blood and tissue kit (Roche), the High Pure Plasmid Isolation kit (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... We recircularized linearized plasmid PCR products with a Rapid DNA Ligation Kit (Roche) and transformed plasmids into DH5α-competent cells (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was amplified using KAPA HiFi HotStart PCR kit (Kapa Biosystems, KK2501) according to the manufacturer’s guidelines and specific primers flanking the CRISPR cut site (with the CRISPR cut site off center ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was purified using a High Pure PCR Template Preparation Kit (Roche, 11796828001) and q-PCR was performed as describe above ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the High Pure Purification Kit (Roche Applied Science). The oligonucleotides used to amplify and sequence the different hit-related genes are listed in Table S4.
-
bioRxiv - Evolutionary Biology 2023Quote: Long-range PCR was conducted using a KAPA LongRange HotStart Kit (KAPA Biosystems) in 25 µl volumes with 24 µl Master-mix (ultra-pure MilliQ water ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was amplified using the 2X KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, now Roche Sequencing ...
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Synthetic Biology 2020Quote: ... taiwanensis VLB120 was used as the template for the PCR and was isolated using the High Pure PCR Template Preparation Kit (Hoffmann-La-Roche, Basel, Switzerland). Plasmids were constructed by Gibson assembly using the NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Immunology 2021Quote: ... 5 μl of the resulting cDNA-containing reverse transcription mixes were then used as templates for 25 μL PCR reactions using the KAPA HiFi PCR kit with GC buffer (Roche Diagnostics, #07958846001) and the following thermal cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... then guide sequences were amplified from gDNA and the plasmid pool by nested PCR using KAPA HIFI Hotstart PCR kit (Kapa Biosystems, KK2501), as previously described in (Young et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cDNA inserts of the plasmids were isolated and amplified by low-cycle (12x) PCR using a Kapa2G Robust Hotstart PCR kit (Roche, Ref #07961073001) according to specifications ...
-
bioRxiv - Microbiology 2023Quote: ... a 710 bp region was amplified by PCR using previously described primers (45) and the KAPA HiFi HotStart ReadyMix PCR Kit (Roche, Basel, Switzerland) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Probe labelling and detection of the blot were carried out using the DIG-DNA labelling mix and detection reagents (Anti-Digoxigenin-AP) (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Real-time quantitative PCR assays were performed using the KOD SYBR® qPCR Mix (TOYOBO) on the Light Cycler 96 system (Roche Diagnostics, Germany). ΔCt method was used for estimating transcript abundance ...
-
bioRxiv - Immunology 2023Quote: ... and the second-strand cDNA was synthesized using a KAPA Biosystems kit (Roche KAPA HiFi Hotstart PCR kit, KK2502) with VHgene-specific primers (No ...
-
bioRxiv - Cancer Biology 2019Quote: Reverse transcription (RT) reactions were carried out using 1 μg of RNA using Transcriptor RT enzyme (Catalog No. 03531287001) from Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Light Cycler 480 Detection System (Roche). The primers used for quantitative RT-PCR are listed in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... for detection in Light cycler LC 480 (Roche). All primers used for qRT-PCR are given in Table-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... in a qPCR detection system (LightCycler LC480, Roche). The sequences are indicated in Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and a LightCycler® 480 Detection system (Roche), following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... and the CDP-star detection system (Roche Diagnostics) as described previously [Commichau et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... For detection of in situ cell death (Roche), sections were processed for proteolytic digestion with proteinase K (Roche ...
-
bioRxiv - Genetics 2023Quote: ... Detection was performed using CSPD chemiluminescent substrate (Roche) on a ImageQuant LAS4000 ...
-
bioRxiv - Microbiology 2023Quote: ... and a LightCycler480 detection system (Roche, Mannheim, Germany). The relative expression of indicated genes was analyzed by the 2-ΔΔCt method ...
-
bioRxiv - Genomics 2019Quote: TUNEL staining on rat β-cells was performed 48h after transfection using the TMR red In Situ Cell Death Detection Kit (Roche) combined to polyclonal guinea pig anti-insulin (dilution 1:40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11644793001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Neuroscience 2020Quote: TUNEL staining was performed according to the manufacturer’s instructions (In Situ Cell Death Detection Kit, Fluorescein, Roche, #11 684 795 910). In brief ...
-
bioRxiv - Neuroscience 2021Quote: Cytotoxicity in the cell cultures (primary cortical neurons and cell lines) was assessed using the cytotoxicity lactate dehydrogenase (LDH) detection kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). Furthermore ...
-
bioRxiv - Immunology 2020Quote: ... For immunohistochemistry paraffin-embedded normal human skin and ES was stained for human Cytokeratin 5/6 according to the manufacturer’s protocol using a Ventana BenchMark Series automated slide stainer with ultraView Universal DAB Detection kit (Roche, 760-500).
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... assay [31] was performed on cryosections of retinal explants using an in situ cell death detection kit conjugated with fluorescein isothiocyanate (Roche, 11684795910). DAPI (Vectashield Antifade Mounting Medium with DAPI ...
-
bioRxiv - Plant Biology 2021Quote: ... Hybridization was conducted according to the procedures described in the DIG High Prime DNA Labeling and Detection Starter kit II protocol (Roche®), using a 725-bp C-terminal TalCMAI1 amplicon as probe (Yu et al ...
-
bioRxiv - Neuroscience 2020Quote: ... The stained cells were further labelled by TUNEL (TdT-mediated dUTP-X nick end labeling) with an In-Situ Cell Detection Kit (TMR red) from Roche (12156792910). Fluorescent images were collected on a Zeiss Automatic stage microscope with Zen blue software ...
-
bioRxiv - Cell Biology 2022Quote: TUNEL assay was performed on N153S and WT lumbar disc tissue sections using an in situ cell death detection kit (Roche Diagnostic). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: Cytotoxicity in primary and cell line cultures was assessed using the cytotoxicity Lactate DeHydrogenase (LDH) detection kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). The culture medium was centrifuged at 500xg for 5min to pellet cell debris before used in the experiments.
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression was analyzed by LightCycler 480 SYBR Green Ⅰ Master kit with LightCycler 480 Detection System (Roche Diagnostics, Mannheim, Germany). qPCR values were normalized by GAPDH expression ...
-
bioRxiv - Genetics 2022Quote: ... Hybridization was performed as described in the Instruction Manual of the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics). Washing conditions was performed according to Huang et al (Huang et al ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The reagents were added in the dark according to the instructions of the In Situ Cell Death Detection Kit (Roche, US). Images were acquired under a fluorescence microscope.
-
bioRxiv - Plant Biology 2019Quote: ... The probes were labeled with digoxigenin (DIG) according to the manufacturer’s protocol (DIG High Prime DNA Labeling and Detection Starter Kit II, Roche, Basel, Switzerland). Northern blot procedures were performed as previously described (Jiang et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... were used as templates to synthesis DIG-labeled probes according to the manufacturer’s protocol (DIG High Prime DNA Labeling and Detection Starter Kit II, Roche, Basel, Switzerland). ULTRAhyb®-Oligo Hybridization Buffer (Ambion ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... Cell death was determined by the TUNEL assay using the In Situ Cell Death Detection Kit Fluorescein (Cat # 11684795910; Roche, Germany); only a signal overlapping a DAPI-stained nucleus was considered positive ...
-
bioRxiv - Immunology 2023Quote: ... Apoptosis also was detected using a terminal deoxynucleotidyl transferase (TdT)-mediated deoxyuridine triphosphate (dUTP)-biotin nick end-labeling (TUNEL) assay with Cell Death Detection Kit (Roche, Germany). Nuclei were stained with 4-6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Microbiology 2023Quote: ... Southern blotting was conducted to confirm the correct deletion using the digoxigenin (DIG) high prime DNA labeling and detection starter Kit I (11745832910 Roche Germany). The Myb gene complementation vectors were constructed by cloning the entire length of the target gene with the native promoter region (about 1.5-kb ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Southern blotting was conducted to confirm the correct deletion using the digoxigenin (DIG) high prime DNA labelling and detection starter Kit I (11745832910 Roche Germany). The MYB gene complementation vectors were constructed by cloning the entire length of the target gene with the native promoter region (about 1.5-kb ...