Labshake search
Citations for Roche :
1601 - 1650 of 1954 citations for Centromere Protein O CENPO Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... the cells were incubated with the anti-HA high affinity antibody (3F10) (1:500 dilution, Roche – cat. 11867423001), followed by incubation with an anti-rat secondary antibody conjugated to Alexa Fluor 488 (1:2000 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with HRP-conjugated rabbit anti-sheep antibodies and detection using ECL reagents (Roche Diagnostic GmbH). A series of timed exposures were undertaken to ensure that densitometric analyses were performed at exposures within the linear range ...
-
bioRxiv - Cell Biology 2020Quote: ... for Western blot analysis probing for HA and FLAG epitopes using 1° antibody = 1:500 mouse αHA (Roche), or 1:500 mouse αFLAG (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were incubated in alkaline phosphatase-conjugated anti-DIG (Digoxygenin) antibody Fab fragments (1:5000; Roche, catalog #12486523) at 1:5000 in the blocking buffer and incubated at 4°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal mouse anti-HA (MMS-101R; Covance) or monoclonal mouse anti-GFP antibodies (11–814–460-001; Roche) prior to secondary antibody treatment with polyclonal goat anti-mouse conjugated to horseradish peroxidase (115–035-146 ...
-
bioRxiv - Cell Biology 2019Quote: Antibodies used for immunofluorescence (IF) experiments in this study were: HA tag (Roche, 3F10/11 867 423 001), giantin (Santa Cruz ...
-
bioRxiv - Physiology 2020Quote: ... The sections were incubated with sheep anti-DIG antibody (1:200, Roche Applied Science; cat. no 1333 089), biotinylated donkey anti-sheep antibody (1:200 ...
-
bioRxiv - Zoology 2019Quote: ... After incubation at room temperature for 4 hours in 1:2000 dilution of anti-digoxigenin antibody (Roche #11376623) prepared in TBST containing 10% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated with an alkaline phosphatase-conjugated anti-digoxigenin antibody (1:1500 in blocking solution; Roche, Switzerland) overnight at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... The expression of KZFP was verified by western blotting with the HA-specific antibody (Roche, Basel, Switzerland; #12013819001). Empty vector-transduced A549 cells (referred to as negative control cells (NC cells) ...
-
bioRxiv - Microbiology 2020Quote: ... permeabilized and immunostained with the following primary antibodies - rat monoclonal anti-HA (clone 3F10, Roche: 1:250 dilution), mouse monoclonal anti-myc (clone 9B11 ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then incubated with primary antibodies used at the following dilutions: mouse-anti-HA (Roche, 1:300), rabbit-anti-γ-H2A.X (Cell signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... An anti-DIG antibody conjugated to alkaline phosphatase and BM purple alkaline phosphatase substrate precipitating solution (Merck Roche) were used for staining ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were incubated in PEMBALG containing monoclonal anti-HA antibody produced in rat (1:1000 dilution, Roche) for one hour ...
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... cell lysate was incubated with agarose beads conjugated with either mouse IgG or mouse anti-GFP antibodies (Roche) for 3h at 4°c under gentle agitation ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then incubated with 40 µL of primary antibody (1:1,000 rat anti-HA mAb 3F10, Roche) at 4°C overnight in a solution containing 3% BSA in PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were then stained for HMGXB4-HA and HMGXB4SUMO -HA using a HA tag antibody (Roche Applied Science) and Fibrillin with Anti-Fibrillin 1 antibody (abcam ...
-
bioRxiv - Microbiology 2020Quote: ... IFAs were carried out on methanol-fixed cells using primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:100 and rabbit α-PfHP1 12 ...
-
bioRxiv - Neuroscience 2021Quote: ... Fcgr1 mRNA signal was then detected using sheep anti-DIG antibody (1:500; Roche Diagnostics Corp., Indianapolis, IN) followed by the secondary antibody (Donkey anti-sheep IgG Alexa 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Cancer Biology 2021Quote: ... The detection kit for the antibodies is the UltraView DAB detection Kit (Ventana Medical Systems Inc./ Roche Diagnostic). A counter-staining of the nuclei was used for 12 minutes by Hematoxylin ...
-
bioRxiv - Developmental Biology 2019Quote: ... After a series of washes the probes were detected using FITC conjugated anti-Digoxigenin antibody (1:20, Roche) amplified with anti-sheep Alexa Fluor 488 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated for 1 h with rat anti-HA high affinity monoclonal antibodies (Roche Applied Science, Penzberg, Germany) at 1:500 ...
-
bioRxiv - Microbiology 2019Quote: ... The HA epitope was detected using horseradish peroxidase (HRP)-conjugated HA antibody (Roche; catalog no. 12013819001 ab 3F10). SAG2 and DP1 were recognized by rabbit polyclonal anti-SAG2 (generated previously (34) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Microbiology 2021Quote: ... and polymerized by UV light prior to labeling with anti-HA antibody (Roche, clone 3F10, 1:40 dilution) and 10nm gold bead conjugated goat anti-rat (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of hybridized probes was performed with anti-DIG antibodies AP fragments (Roche, Basel Switzerland; dilution 1:1000) overnight at 4°C ...
-
bioRxiv - Plant Biology 2019Quote: ... and incubated with anti-c-Myc primary antibody solution (GenScript, 1: 2,000 dilution in 1×TBS-T with 0.2% Blocking Reagent [Roche]) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Input and antibody-bound fractions were quantified by real-time PCR amplification with the SYBR Green mixture (Roche) using a LightCycler 480II (Roche ...
-
bioRxiv - Plant Biology 2019Quote: ... and incubated with anti-Mouse IgG-HRP secondary antibody solution (Sigma, 1:10,000 dilution in 1×TBS-T with 0.2% Blocking Reagent [Roche]) for 1-2 hrs ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Cancer Biology 2020Quote: ... was used to remove excess antibody and amplified C-circles were detected with CDP-Star® kit (Roche). Membranes were imaged with the Odyssey® Fc Imager (LI-COR ...
-
bioRxiv - Developmental Biology 2022Quote: ... blocked in TBTX/BSA/Sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... Hybridized probes were detected by anti-DIG antibodies conjugated with alkaline phosphatase enzyme (anti-DIG-AP) (Roche, Germany). Photographs were captured using an Olympus BX51 compound microscope using a DP74 Olympus camera.
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... in antibody buffer (20 mM HEPES pH 7.5; 150 mM NaCl; 0.5 mM Spermidine; 1X Protease inhibitor cocktail (Roche); 0.05% Digitonin ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 20% of the elution sample volume was analyzed by western blotting with α-HA tag antibody (#3F10, Roche) for Sly1-HA immunodetection.
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was first performed with high or low pH buffer depending on the primary antibody (CC1m, Roche or low pH antigen retrieval buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... probes were detected using anti-digoxigenin and anti-fluorescein antibodies with Fab fragments conjugated to horseradish peroxidase (Roche). 1:500 fluor-tyramide (TAMRA or FAM) ...
-
bioRxiv - Immunology 2023Quote: ... sorted cells were washed with PBS and resuspended in Antibody Buffer (1X eBioscience Perm/Wash Buffer, 1X Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...