Labshake search
Citations for Roche :
1551 - 1600 of 1612 citations for IL 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... qPCR mix was prepared in a total volume of 10 μL with 5 μL of LightCycler® 480 SYBR Green I Master (Roche, Basel, Switzerland), 4 μL of diluted cDNA (or water for the negative control ...
-
bioRxiv - Molecular Biology 2019Quote: ... 250 mM sucrose, 5 mM MgCl2, 1 mM EGTA, 0.05% Tween-20, 0.5 mM DTT, 1x protease inhibitors [Roche], 0.4 u/μl RNase inhibitor). The nuclei or permeabilized cells were flash-frozen and stored at −80°C (10 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/ml SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 0.5% SDS, 0.5% SDO, 1% Triton X-100, 1 mM PMSF, Roche cOmplete Mini Protease Inhibitors 1x), and homogenized (Precellys Evolution ...
-
bioRxiv - Cell Biology 2021Quote: ... along with the appropriate antibody (mouse HA 12CA5, 7.5 μl 0.4 mg/ml, Roche; mouse M2 FLAG, 5 μl 1 mg/ml, Sigma), before incubating at 4 °C on a rotating wheel at 14 rpm for 15-18 h ...
-
bioRxiv - Biochemistry 2022Quote: ... The PVDF membrane was blocked with 5% skim milk in TBS for 1 h and incubated with anti-HA-HRP (Roche, 3F10, 1:5000) in 5% milk/TBS ...
-
bioRxiv - Microbiology 2022Quote: ... The 10 μL reaction mixture included 5 μL Kapa SYBR Fast Universal 2x qPCR master mix (Kapa Biosystems, Lab Supplies Scientific SA, Hellas), 5 ng of cDNA template ...
-
bioRxiv - Microbiology 2022Quote: ... Approximately 800 μg of VLP lysate was then reduced and alkylated as described above and treated with 5 U PNGase F (Roche Cat. Nr. 11365177001) at 37 °C for 12 hours followed by 12 hours with 11 μg of trypsin ...
-
bioRxiv - Microbiology 2021Quote: ... and Fwd-P2 (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAGBBBBBBAGARTTTGATCYTGGTTCAG and the reverse primer was Rev1B (5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG. The PCR products were sequenced on the 454 GS FLX Titanium sequencer (Hoffmann-La Roche, LTD; Basel, Switzerland). Through the Research Alliance for Microbiome Science Registry (IRB no ...
-
bioRxiv - Neuroscience 2022Quote: ... 2X SSC was replaced with 1X DNase buffer for 5 min and then a 1:50 dilution of DNase I in DNase buffer (DNase I recombinant, RNase-free, Roche, Cat. No. 04716728001), and incubated for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... 2X SSC was replaced with 1X DNase buffer for 5 min and then a 1:50 dilution of DNase I in DNase buffer (DNase I recombinant, RNase-free, Roche, Cat. No. 04716728001), and incubated for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/mL SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: GST-tagged CBX8 was purified by re-suspending thawed cell pellets in 30 ml of lysis buffer (1× PBS, 5 mM DTT, 1× EDTA free protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN)) per liter of culture ...
-
bioRxiv - Microbiology 2019Quote: ... where N5 represents 5 random bases used to improve sequencing quality) using 25 µL of Kapa Hifi mastermix (Kapa Biosystems, Woburn, MA, USA), 2.5 µl of each primer (10 µM) ...
-
bioRxiv - Developmental Biology 2019Quote: ... ESCs cells and neurospheres were harvested and lysed in TEN buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% Na-Deoxycholate, supplement with Roche cOmplete™ Protease Inhibitor). The lysates were quantified by the Bradford method and equal amount of proteins were loaded for Western blot assay ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, 5 mM EDTA, 50 mM NaF, 1 mM PMSF supplemented with Roche 1X Halt Protease inhibitor cocktail), incubated for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested and lysed using immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Approximately 1.5 mg of lysate from each sample was incubated with brachyury antibody at 4°C for 4 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were pooled together and resuspended in 1.5 mL immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Cells were then incubated for 30 minutes on ice prior to centrifugation at high speed (15,000 rpm ...
-
bioRxiv - Immunology 2020Quote: ... at 37° C 5% CO2 in 96 well plates in the presence of IL2 (GIBCO 100 IU/mL or Roche 1 ng/mL). Additional conditions included 1 ng/mL TGFβ (GIBCO) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM DTT, 150 mM NaCl, 5 mM MgCl2, 0.001% Triton X-100, 1mM PMSF, 0.2 mM GDP, Roche cOmplete EDTA-free protease inhibitors) and lysed with a microfluidizer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... 1% SDS, 1 mM EDTA, 1 mM DTT, 1 mM Na3VO4×2H2O, 5 µM pepstatin A, 10 µM leupeptin, 2X Roche protease inhibitor cocktail), 200µl glass beads were added ...
-
bioRxiv - Plant Biology 2022Quote: ... and then mixed with 4ml protein extraction buffer (50mM Tris/HCl pH 7.5, 5% glycerol, 150mM NaCl, 0.2% triton X-100, cOmplete™ EDTA-free protease inhibitor tablets [Roche] - one per 10ml buffer) as soon as the ground tissue had reached room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... protein extraction buffer (50mM Tris/HCl pH 7.5 or HEPES pH 7.5, 150mM NaCl, 5% glycerol, 0.5% NP-40, cOmplete™ EDTA-free protease inhibitor tablets [Roche] - one per 10ml buffer) was added to the tissue and grinding was continued until a homogenous suspension was formed ...
-
bioRxiv - Biochemistry 2023Quote: ... then lysed in ice-cold NP-40 lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1mM EDTA, 1% NP-40, 5% glycerol, Roche cOmplete protease inhibitor cocktail) by trituration followed by incubation on ice for 10 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... pH 7.5, 150 mM NaCl, 1 mM EDTA, 10 % [v/v] glycerol, 1 mM DTT, and 1 × complete Protease Inhibitor [Roche; Cat. No. 058929700001]) was added to homogenised plant material (100 μl extraction buffer per 100 mg plant material) ...
-
bioRxiv - Biochemistry 2023Quote: ... and collected by centrifugation at 7,500 RCF for 15 minutes and then suspended in Lysis Buffer D (20 mM HEPES pH 8, 200 mM NaCl, 5 mM imidazole, 0.5 mM Imidazole, 1x Roche EDTA free protease inhibitor). Cells were lysed using an emulsifier (AvestinEmulsiflexC3 ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were suspended in Resuspension Buffer A (20 mM HEPES pH 8, 150 mM NaCl, 5% glycerol, 0.5 mM TCEP, Roche EDTA free protease inhibitor) and lysed using an emulsifier (AvestinEmulsiflexC3) ...
-
bioRxiv - Genetics 2023Quote: ... Washed cells were carefully resuspended in 570 μL Buffer A with additives (0.2 mM spermidine, 0.5 mM spermine, 1 mM PMSF, ½ cOmplete ULTRA protease inhibitors tablet, Roche, per 5 mL Buffer A) and permeabilized with 0.1% digitonin in 30 ° C water bath for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in 10 ml of extraction buffer (pH 6.7) (250 mM sucrose, 120 mM KCl, 10 mM MOPS, 5 mM MgCl2, 1 mM DTT, 1 Roche protease inhibitor cocktail tablet) (Vought et al ...
-
bioRxiv - Genetics 2024Quote: ... Washed cells were carefully resuspended in 570 μL Buffer A with additives (0.2 mM spermidine, 0.5 mM spermine, 1 mM PMSF, ½ cOmplete ULTRA protease inhibitors tablet, Roche, per 5 mL Buffer A) and permeabilized with 0.1% digitonin in 30 ° C water bath for 5 min ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... ear punch biopsy samples were homogenized in lysis buffer (50 mM Tris-base, 150 mM NaCl, 5 mM EGTA supplemented with EDTA-free complete protease inhibitor (Roche Diagnostics GmbH, Mannheim, Germany) and 0.5% Triton X-100) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Microbiology 2019Quote: ... DNA fragments encompassing TPP riboswitches and the first 5 codons of the downstream gene were amplified from genomic DNA by PCR using HiFi Taq MasterMix (KAPA Biosystems, Wilmington, MA, USA) and inserted in frame preceding the nanoluciferase gene in the pNBU2 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on a rotator and S1 (1 ml for cerebellum and 1 ml for cerebrum) was incubated with 5 μg of anti-HA mAb (Roche, clone 12CA5, RRID: AB_514505) at 4°C for 60 min on a rotator ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIGprobes were detected with antibodies in MABT containing 5% horse serum appropriate for NBT/BCIP in situ hybridization (Roche anti-DIG-AP 1:1000) or for FISH (Roche anti-DIG-POD 1:1000) ...
-
bioRxiv - Biochemistry 2019Quote: ... pooled together and placed in buffer H (10 mM HEPES pH 7.5, 5 mM MgCl2, 25 mM KCl, 0.25 M sucrose supplemented with Complete protease inhibitors cocktail, Roche Products Ltd, Welwyn Garden City, UK) at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell pellets were resuspended in lysis buffer (50 mM HEPES-NaOH, pH 7.5, 500 mM NaCl, 5% v/v glycerol, 1 mM TCEP-NaOH, Roche protease inhibitor cocktail EDTA-free) at the ratio of 50 ml / L equiv ...
-
bioRxiv - Developmental Biology 2019Quote: ... and subsequently incubated in antibody solution (5% Sheep serum, 1% Tween20 and 1:2500 dilution of Alkaline Phosphatase-linked α-Digoxigenin antibody, Roche, 11093274910 in TBST) for 2 h at RT ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and homogenized in 5 volumes of ice-cold PBS containing 1% NP-40 and Complete® protease inhibitor cocktail tablets (Roche Diagnostics, Basel, Switzerland) using 2×10 clockwise strokes with 5 s rest time ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.