Labshake search
Citations for Roche :
1551 - 1576 of 1576 citations for IL 5 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Microbiology 2019Quote: ... DNA fragments encompassing TPP riboswitches and the first 5 codons of the downstream gene were amplified from genomic DNA by PCR using HiFi Taq MasterMix (KAPA Biosystems, Wilmington, MA, USA) and inserted in frame preceding the nanoluciferase gene in the pNBU2 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on a rotator and S1 (1 ml for cerebellum and 1 ml for cerebrum) was incubated with 5 μg of anti-HA mAb (Roche, clone 12CA5, RRID: AB_514505) at 4°C for 60 min on a rotator ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIGprobes were detected with antibodies in MABT containing 5% horse serum appropriate for NBT/BCIP in situ hybridization (Roche anti-DIG-AP 1:1000) or for FISH (Roche anti-DIG-POD 1:1000) ...
-
bioRxiv - Biochemistry 2019Quote: ... pooled together and placed in buffer H (10 mM HEPES pH 7.5, 5 mM MgCl2, 25 mM KCl, 0.25 M sucrose supplemented with Complete protease inhibitors cocktail, Roche Products Ltd, Welwyn Garden City, UK) at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell pellets were resuspended in lysis buffer (50 mM HEPES-NaOH, pH 7.5, 500 mM NaCl, 5% v/v glycerol, 1 mM TCEP-NaOH, Roche protease inhibitor cocktail EDTA-free) at the ratio of 50 ml / L equiv ...
-
bioRxiv - Developmental Biology 2019Quote: ... and subsequently incubated in antibody solution (5% Sheep serum, 1% Tween20 and 1:2500 dilution of Alkaline Phosphatase-linked α-Digoxigenin antibody, Roche, 11093274910 in TBST) for 2 h at RT ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and homogenized in 5 volumes of ice-cold PBS containing 1% NP-40 and Complete® protease inhibitor cocktail tablets (Roche Diagnostics, Basel, Switzerland) using 2×10 clockwise strokes with 5 s rest time ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Neuroscience 2024Quote: ... resuspended in 150 μL buffer C (50 mM Tris pH 8, 5 mM EDTA, 1% SDS, 100 mM NaCl, 1x Roche complete mini protease inhibitors) and incubated on ice for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA (5∼8 μg) for Nanopore sequencing was end-repaired and ligated via a KAPA Hyper Prep Kit (Cat#KR0961, Kapa Biosystems, Wilmington, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and lysis buffer A (50 mM Tris-HCl, 5 mM EDTA, 10 mM NaN3, and Complete™ EDTA-free tablet; Roche Diagnostics, Mannheim, Germany); disrupted with glass beads at 4 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were lysed in 100 µl lysis buffer (5 ml contain: 10 mM Tris-HCl pH 7.5, 4% SDS, 1 PhosSTOP tablet [Roche], a scoop of DNase I [NEB]) for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 mM NaCl, 30 mM imidazole, 1 M urea, 1% v/v Triton X-100, 5 mM beta-mercaptoethanol, with Roche EDTA-free cOmplete protease inhibitor) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... 42 ℃ for 5 min and 95 ℃ for 10 s followed by 40 cycles of 95℃ for 5 s and 60 ℃ for 20 s on an LightCycler® 480 Instrument (Roche Diagnostics Ltd, Rotkreuz, Switzerland). The absolute quantification of SARS-CoV-2 RNA levels was performed by comparison to a standard curve and shown as SARS-CoV-2 RNA copies per mouse ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Immunology 2024Quote: ... and 0.5% Triton X-100) with 1x protease and phosphatase inhibitors (c0mplete™ Protease Inhibitor Cocktail, Roche, product number 04693159001; PhosSTOP™, Roche, product number 04906837001). The resulting lysate was transferred to a labeled 1.5mL tube and placed on ice ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Physiology 2021Quote: ... denatured for 10 minutes at 80°C in hybridization buffer (0.1M Tris, pH 7.2; 25mM MgCh; 70% formamide [Sigma-Aldrich, Saint Louis, MO], 5% blocking reagent [Roche] with 1.0μg/mL of Cy3-labelled (F3002) CENPB-specific [ATTCGTTGGAAACGGGA] peptide nucleic acid (PNA ...