Labshake search
Citations for Roche :
1401 - 1450 of 1576 citations for IL 5 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... to amplify the ligation product with 5 PCR cycles using 2x KAPA-HiFi HS Ready Mix and 10X KAPA primer mix (Roche Kapa Biosystems). The libraries were sequenced on HiSeq 4000 or NovaSeq 6000 (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mg of plasmid DNA was transfected into HMEC P5 was transduced into Phoenix packaging cells using Fugene (Roche, Basel, Switzerland). Viral supernatant was harvested 48 h after transfection ...
-
bioRxiv - Bioengineering 2022Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...
-
bioRxiv - Developmental Biology 2022Quote: ... The tissue was then washed with PBT extensively (10 times or more for 5 minutes) before development with BM-purple (1ml per well, Roche Diagnostics). Time of development was approximately 20 minutes at room temperature to 24 hours at 4°C depending on the probe ...
-
bioRxiv - Cell Biology 2022Quote: ... of siCon or siRictor NIH3T3 cells co-expressing Flag-NDRG1 WT were homogenized in 2% SDS + 5 mM DTT to retrieve proteins in solution supplemented with complete EDTA-free protease inhibitor (Roche, 11873580001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 ml of digestion buffer containing collagenase D (2mg/ml, Roche #11088858001) and DNase (0.125 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue sections were equilibrated in hybridization solution (40 mL of prehybridization solution, 1.6 mL of 5 mg/mL, and 25 mg Roche yeast RNA) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... We equilibrated the sections in hybridization solution (50 mL of prehyb solution, 1.6 ml of 5 mg/ml, and 25 mg Roche yeast RNA) for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... for 45 seconds at 6,000 rpm × 3 (and placed on ice for 5 min at the end of each 45 second homogenization) using a Roche Magnalyser instrument (Roche, Germany). RNA was then isolated as per Invitrogen’s manufacturer’s instructions for Tri-reagent ...
-
bioRxiv - Molecular Biology 2022Quote: ... and developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoxyl phosphate (BCIP; Roche, Switzerland) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and then the detection reaction was carried out in a buffer containing 3.5 µl/ml of of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Bâle, Switzerland). The reaction was stopped with 50 mM EDTA in PBS and embryos were washed in PBSTw ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl from the partially amplified barcoded fragments was subjected to SYBR Green qPCR in a LightCycler 480 System (Roche, Germany) using the FastStart Essential DNA Green Master Mix (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were washed and lysed in 2 mL of lysis buffer (containing in mM: 50 Tris pH 7.2, 5 EDTA, 150 NaCl, 10 NEM, Protease Inhibitor Cocktail (Roche, Basel, Switzerland), 2 PMSF ...
-
bioRxiv - Molecular Biology 2024Quote: ... crosslinked chromatin was resuspended in 1 mL Farnham Lysis Buffer (FLB; 5 mM HEPES pH 8.0, 85 mM KCl, 0.5% NP-40/IGEPAL, Roche Protease Inhibitor Cocktail), centrifuged ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were resuspended in twice their volume of buffer A (50 mM HEPES pH 7.5, 500 mM KCl) with 5 mM MgCl2 and DNase I (Roche, Basel, Switzerland). The cell suspension was treated with a Sonopuls GM200 sonicator (BANDELIN electronic GmbH & Co ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: ... cDNAs were diluted to 1 ng/ µL and used for qPCR analysis in a 10 µL reaction mix containing 5 µL of LightCycler® 480 SYBR Green I Master mix (Roche), 300 nM of each primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... in addition to qPCR on the Applied Biosystems QuantStudio 5 Real-Time PCR System using the Roche KAPA Library Quantification Kit (Roche, KK4824) to determine the concentration of adapter-ligated libraries ...
-
bioRxiv - Microbiology 2023Quote: ... Cross-linked cells were lysed by sonication in lysis buffer (5 mM EDTA, 1% NP-40 in PBS) supplemented with 2X cOmplete™ inhibitor (Roche). Cell lysates were treated with 2 units of Turbo DNase (Life Technologies ...
-
bioRxiv - Zoology 2023Quote: ... Single staining was performed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; 1:50 dilution in alkaline buffer; Roche Diagnostics). The cells were then stained overnight at room temperature.
-
bioRxiv - Microbiology 2023Quote: ... beads with protein were subjected to overnight digestion by adding 100 µl 5 ng/µl sequencing grade trypsin (Roche Diagnostic GmbH) in ammonium bicarbonate (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... indexes and sequencing sequences) was performed on 5 µl of purified first step PCR products using Expand™ Long Template PCR System (Roche) with the following thermocycling program ...
-
bioRxiv - Neuroscience 2023Quote: ... The hybridization signal was revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 in a proportion of 0.45 µl of NBT and 4.5 µl of BCIP in 5 ml of B2 ...
-
bioRxiv - Microbiology 2023Quote: ... 300 mM NaCl and 2 mM β -mercaptoethanol) per 5 × 108 cells in the presence of EDTA-free anti-protease cocktail (complete from Roche). Lysis was performed with two cycles of freezing (− 180 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... the cells were rinsed with PBS and incubated with 5% (v/v) normal donkey serum and 1% (w/v) BSA (Roche, 10.7350.86001) in PBS for 1 hour at room temperature to block the non-specific antibody binding ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA, 10 mM β-mercaptoethanol, 10 mM Hepes pH 7.5, supplemented with 1× Complete protease inhibitor cocktail, Roche, Germany), passed through 27 G syringe and left 20 min in ice ...
-
bioRxiv - Genomics 2023Quote: ... and Illumina PCR-free libraries were prepared from 700 ng DNA using the KAPA Hyper prep kit and unique dual-indexed adapters (5 µL of a 15 µM stock) according to the supplier’s protocol (Roche, Basel, Switzerland). The library concentration and size distribution were assessed on a Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... 150 mM KCl, 5 mM MgCl2, 0.05% NP-40, EDTA-free cOmplete mini protease inhibitor [Roche, 11836153001], PhosSTOP [Roche, PHOSS-RO]). If indicated ...
-
bioRxiv - Physiology 2024Quote: ... the samples were blocked with 5% skim milk in PBS-DEPC for 1 hour at 4°C and incubated with anti-DIG antibody (Roche Diagnostics) diluted 1:10,000 in the blocking buffer for 1 hour at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 % NP40, 2.5 mM EDTA, 0.05 % NaDeoxycholate, 20 mM Tris-HCl pH 8, 1x of PhosSTOP, 1x Roche protease inhibitor mixture), and the TE buffer (same as for histones plus 1x PhosSTOP) ...
-
bioRxiv - Biochemistry 2023Quote: ... The S100 extract was eluted from DEAE resin with 5 ml of S100 Elution Buffer (250 mM KHPO4 (pH 6.5),1x Mini protease inhibitor cocktail tablet (Roche, Basel, Switzerland)) and aliquoted and flash-frozen in liquid nitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 ng of DNA from each sample was analyzed using the Kapa Cyber Fast Q-PCR Kit (Kapa Biosystems, Wilmington, MA). The following rDNA primers (designed using Primer3Plus software ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Physiology 2024Quote: ... for 45 s at 6,000 rpm×3 (and placed on ice for 5 min at the end of each 45 s homogenization) using a Roche MagNA Lyser instrument (Roche, Germany). RNA was extracted using standard Tri-Reagent procedure via chloroform/isopropanol extractions and 75% ethanol washing as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Bacterial cell pellets were resuspended in 50 ml of lysis buffer (50 mM Tris-HCl pH 8, 1 mM DTT, 5% glycerol, protease inhibitor cocktail [Roche 1183615300]). Cells in pellets were lysed by sonication on ice with 10 sec pulses of maximum setting followed by 1 min cooling period ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and cell pellets were resuspended in twice their volume of buffer A (50 mM HEPES pH 7.5, 500 mM KCl) with 5 mM MgCl2 and DNase I (Roche, Basel, Switzerland). Cells were lysed by sonication using a SonoplusGM200 (BANDELIN electronic GmbH & Co ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pellets of CoREST and LSD1 were resuspended in lysis buffer (50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 5% glycerol, 7.5 mM imidazole supplemented with PMSF, DNAse and EDTA-free Roche protease inhibitor cocktail) in a weight ratio of 1:1.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... with ATP standard solutions used at concentrations between 10−8 and 10−5 M (luciferin/luciferase ATP bioluminescence assay kit CLSII, Roche, Basel, Switzerland). Data are expressed as nmol ATP produced/min/106 cells.
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol and Roche Complete Protease Inhibitors) and homogenized using a high-performance disperser (Fisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... ESCs or HEK293T cells were harvested and lysed in TEN buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% Na-Deoxycholate, supplement with Roche cOmplete Protease Inhibitor). The lysates were quantified by the Bradford method and equal amount of proteins were loaded for Western blot assay ...
-
bioRxiv - Immunology 2021Quote: ... ATAC-seq libraries were amplified using 5 μl each of the i5 and i7 Nextera Indexing primers and 25 μl of 2x HiFi HotStart ReadyMix (Roche Diagnostics, KK2601). Final libraries were purified using 1x volumes of AMPureXP SPRI-beads and sequence using 75bp paired-end reads on an Illumina NextSeq500.
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...