Labshake search
Citations for Roche :
1451 - 1500 of 2467 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... 5 mM Sodium Pyrophosphate and complete EDTA-free protease inhibitor cocktail (Roche). After 15 min of incubation in hypotonic solution ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% Glycerol and Complete EDTA-free antiprotease cocktail (Roche, Boulogne-Billancourt, France)) ...
-
bioRxiv - Biochemistry 2022Quote: ... and 5% SDS) and digested with 1.25 mg/ml Proteinase K (Roche) for 60 min at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... including 5 μL template using LightCycler Multiplex RNA Virus Master (Roche, Switzerland). All assays were carried out in triplicate on the Roche Lightcycler 96 platform (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was digested with DNase-free RNase (5 μg/ml, Roche #11119915001) for 1 hour at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% Glycerol and EDTA free protease inhibitor cocktail tablet/50ml (Roche, UK)] ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA) with freshly added protease inhibitor cocktail (Roche, cat #11836170001). Lysates were passed through a 26G syringe and protein was quantified by DC Protein Assay (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... 5% glycerol (v/v%)) and dispensed into white 96-well plates (Roche). Compound (1 mM ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM 2-mercaptoethanol and cOmplete Protease Inhibitor Cocktail (Roche, no. 11697498001). The cell suspension was subjected to sonication (Qsonica ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 μL of FastStart SYBR Green Master (Roche Diagnostics, Indianapolis, IN USA), 0.4 μL of qRT-PCR primers (Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... Blocking was performed with 5 % Bovine serum albumin (Boehringer Mannheim, now Roche) in 1x PBST (1x PBS with 0.05 % Tween-20 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5µL SYBR Green I Master mix (5 mL: Roche Diagnostics, Indianapolis, IN) and 2 µL of distilled and deionized H2O ...
-
bioRxiv - Biochemistry 2023Quote: ... and applied to a 5 mL cOmplete His-tag purification column (Roche). The column was then washed with ∼100 mL of lysis buffer and bound proteins were eluted in 25 mL of lysis buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2.5 µL of 5 µM dT overhang adapter (Roche, cat. no. KK8727) was used for the End Prep reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The membranes were blocked in 5% BSA (Roche, 10 735 086 001) in TBS-T before overnight incubation at 4°C with primary antibodies ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2023Quote: ... Aliquots (+Ab) were incubated with 5 µg antibody [anti-HA (3F10, Roche) or anti-MYC (AB9106 ...
-
bioRxiv - Genomics 2023Quote: ... and 0.08U KAPA2G Robust HotStart DNA Polymerase (5 U/mL, Roche KK5517). PCR reactions were performed using a thermocycler with the following conditions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μM LMD-009 and EDTA-free protease inhibitor cocktail tablets (Roche). Then the suspension was incubated at room temperature for 1.5 h after adding apyrase (25 mU/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 mM NaF and 5 mM Na3VO4) containing protease/phosphatase inhibitors (Roche). Cells were incubated in lysis buffer for 2-3 hours in rotator at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were then thawed and resuspended in 1 ml lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 0.5 mg/ml lysozyme, 2 mM EDTA and one Roche protease inhibitor tablet per 10 ml). Complete lysis was achieved after a 15-min incubation at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... per sample was washed 3 times with cold 1X PBS and 2μg anti-GFP monoclonal antibody (Roche) per sample was conjugated with Dynabeads in 1ml cold PBS at 4°C for 4h ...
-
bioRxiv - Genomics 2022Quote: ... 25µl of Red ANTI-FLAG M2 Affinity Gel from SIGMA ALDRICH (F2426) were washed 3 times with TBS (50mM TRIS pH 7.5,150mM NaCl and protease inhibitor tablets [Roche]) and then added to samples ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 µl Universal Nuclease Mix (Pierce™) and 1 tablet of cOmplete™ Protease Inhibitor Cocktail (Roche) were added and the cells were lysed via sonication ...
-
bioRxiv - Microbiology 2022Quote: ... at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat. Nr. 11418025001) at 37 °C for 13 hours ...
-
bioRxiv - Microbiology 2019Quote: ... were transfected with 20 ng pNF-□B-Luc and 3 ng pRL-TK using FuGENE 6 (Roche). Transfected cells were incubated for 24 h (37°C ...
-
bioRxiv - Genetics 2020Quote: Exon 3 of the MSH2 gene was PCR amplified using the Expand High Fidelity PCR kit (Roche) with the following conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Immunology 2020Quote: ... gently mechanically disaggregated and resuspended in PBS 1x containing 3 mg/ml of collagenase D (Roche Diagnostics) plus 10 μg/ml of DNAse (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The harvested molars were pooled and dissociated with 3 U/mL Collagenase P (COLLA◻RO, ROCHE) followed by incubation for 45◻minutes in a 37°C shaking water bath ...
-
bioRxiv - Genomics 2021Quote: Mice livers were perfused and dissociated into single cells using Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) as previously described8 ...
-
bioRxiv - Plant Biology 2022Quote: ... Chloroplast were lysed osmotically in buffer 3 (25mM HEPES-KOH, pH 8.0) containing cOmplete protease inhibitor (Roche) and either separated into soluble and pellet fraction by centrifugation for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 mM MgCl2; 0.1 % NP-40; 0.2 U/µl RNaseOUT; 0.32 M Sucrose; 1x protease inhibitor, Roche) and transferred to 2 ml Dounce tissue grinder (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 ng ds-cDNA was processed for library construction using KAPA Hyper Prep Kit (Kapa Biosystems #KK8504) according to the standard protocol except that a 15-min USER enzyme (BioLab # M5505L ...
-
bioRxiv - Systems Biology 2023Quote: ... 3 mM MgCl2 and 0.1% IGEPAL CA-630) supplemented with 0.2U/µl of RNAse Protector (Roche, Switzerland), was added to each sample ...