Labshake search
Citations for Roche :
1451 - 1500 of 8118 citations for 7 R AMINO PHENYL ACETAMIDO 3 METHYL 3 CEPHEM 4 CARBOXYLIC ACID DIMETHYLFORMAMIDE 2 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 0.25% Triton supplemented with protease inhibitor at 4□°C (Roche, 04693159001) for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 mM MgSO4) containing Complete Inhibitor Protease Cocktail (Roche, Indianapolis, IN), lysozyme and DNAse ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C overnight and subsequently developed with NBT/BCIP (Roche). For FISH ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 complete-EDTA protease-inhibitor tablets per 500 mL (Roche). After thawing ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA (4 ng) and LightCycler 480 SYBR Green I Master (Roche) in a final volume of 10 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... and detection with 4-Nitro blue tetrazolium chloride (NBT; 11383213001, Roche) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Neuroscience 2023Quote: ... 4% BlockAce (DS Pharma Biomedical) and 0.5× Blocking reagent (Roche Diagnostics)] for 1 hr at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Immunohistochemistry was performed on 4 μm sections using the BenchmarkUltra (Roche), anti-hCD45 (M0701 ...
-
bioRxiv - Genetics 2021Quote: ... each sample was amplified in 6/2 PCR reactions (2 µg DNA/reaction) in the primary/secondary screens using the ReadyMix Kapa polymerase (Roche) with a total of 20 cycles and an annealing temperature of 55°C (Primer sequences in Table S4 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2×106 cells HEK293T cells were transfected with 2 μg plasmid DNA using X-tremeGENE HP DNA Transfection Reagent (Roche) in 10-cm dishes ...
-
bioRxiv - Cell Biology 2024Quote: ... The parasites were pelleted by centrifugation at 25,000 x g and resuspended in 5 × the pellet volume with hypotonic lysis buffer (1 mM HEPES-NaOH pH 7.4, 2 mM EGTA, 2 mM DTT with protease inhibitor cocktail; cOmplete™, EDTA-free, Roche). The parasite suspension was incubated for 10 min on ice and then lysed by approximately 30 passages through a 1mL syringe fitted with a 27G needle.
-
bioRxiv - Immunology 2023Quote: ... dissociated from the coverslips in 8 M urea lysis buffer (100 mM NaCl, 25 mM Tris, 2% SDS, 0.1% tween 20, 2 mM EDTA, 0.2 mM PMSF, and 1x Roche cOmpleteProtease inhibitor). Lysates were treated with benzonase (Sigma ...
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Physiology 2021Quote: ... Trypsin activity was then inhibited by adding to the homogenate bovine serum albumin (BSA) fatty acid free (0.25 mg/mL) and protease inhibitor cocktail (PIC, Roche).
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and then sonicated ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was purified with High Pure Viral Nucleic Acid Kit according to the manufacturer’s instruction (ROCHE, Mannheim, Germany). Viral RNA was amplified by LightMix® Modular Sarbecovirus E-gene (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... the nucleic acid pellet was resuspended in 38μL of DNase buffer and 2μL of 10U/μL DNase I (Roche, #04716728001), gently mixed ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mM EDTA with 1x protease inhibitors (Roche). Protein concentrations were quantified with a BCA Kit (Thermo Fisher ...
-
bioRxiv - Immunology 2021Quote: ... For cDNA synthesis 2 μg of DNaseI (Roche) treated total RNA was reverse transcribed using M-MuLV reverse transcriptase (Minotech) ...
-
bioRxiv - Genetics 2019Quote: ... 2 mM benzamidine and protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x KAPA HiFi buffer (Kapa Biosystems), 0.3 µl 10 mM dNTPs (Kapa Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitors (Roche) and 300 U/L benzonase (Sigma) ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM Na3VO4 and protease inhibitor cocktail (Roche), 1 tablet per 10 ml) ...
-
bioRxiv - Immunology 2019Quote: ... 100U/mL IL-2 (Roche Diagnostics or Biolegend) was used throughout ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 mM PMSF) supplemented with cOmplete™ (Roche) protease inhibitors ...
-
bioRxiv - Genomics 2019Quote: We used DAPI “40,6-diamidino-2-phenylindole” (Roche) with “SlowFade” antifade reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl biotin-16-dUTP (Roche 11093070910), and were incubated at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... and/or DAPI (Roche: 10236276001, 2 μg/mL) before mounting to visualize barrel map ...
-
bioRxiv - Biophysics 2020Quote: ... supplemented with 100 U/mL Il-2 (Roche). K562 cells were obtained from ATCC (CCL-243 ...
-
bioRxiv - Neuroscience 2019Quote: ... 10X expand long template buffer 2 (Roche, 11681842001), expand long template enzyme mix (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... containing 2 mg/ml Collagenase A (#10103586001, Roche), 2.4 U/ml Dispase II (#04942078001 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM 2-Mercaptoethanol and protease inhibitor (Roche). The lysis proceeded by 3 passages in a French press cell at a pressure of 1500 psi ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μg/mL DNAse (11284932001, Roche Diagnostics), and incubated for at least 10 min on ice before sonication (10 cycles of 15 s with 30 s cooling at 8 microns amplitude ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2% BSA fraction V (Roche Diagnostics, Mannheim, Germany), 10 mM nicotinamide (Merck Millipore ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM benzamidin and protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mg/ml protease inhibitor cocktail (cOmplete, Roche)] on ice for 30 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 tablets of the protease inhibitor cocktail (Roche) per 100 mL] ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 tablet of complete protease inhibitor cocktail (Roche) 2mM DTT ...
-
Single cell transcriptomics reveals the effect of PD-L1/TGF-β blockade on the tumor microenvironmentbioRxiv - Genomics 2020Quote: ... anti-PD-L1 (atezolizumab, Roche, 2 mg/kg), anti-TGF-β (mouse IgG1 clone 1D11 from BioXCell ...
-
Single cell transcriptomics reveals the effect of PD-L1/TGF-β blockade on the tumor microenvironmentbioRxiv - Genomics 2020Quote: ... anti-PD-L1 (atezolizumab, Roche, 2 mg/kg), or a combination of anti-PD-L1 (2 mg/kg ...