Labshake search
Citations for Roche :
1351 - 1400 of 7700 citations for 7 R AMINO PHENYL ACETAMIDO 3 METHYL 3 CEPHEM 4 CARBOXYLIC ACID DIMETHYLFORMAMIDE 2 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2 PhosStop™ phosphatase inhibitor tablets (Roche), 1mM PMSF ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 mg/ml pronase (#10165921001, Roche) via the trachea and incubating for 30 minutes at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... 100 U/mL human IL-2 (Roche), 50 ng/mL human IL-21 (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... Collagenase A 2 mg/ml (Roche, 10103578001), CaCl2 5 Mm (Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2× cOmplete proteinase inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2024Quote: ... was washed once with 80 mL of lysis buffer 1 (20 mM Tris-HCl, pH 8.0) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Two mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland,05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Genomics 2019Quote: ... 2015) that uses the tube assemblies from the High Pure Viral Nucleic Acid Large Volume kit (Roche, 05114403001). The intact ossicles were placed in the extraction buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... membranes were blocked with 10 mL of 1x blocking solution diluted in 1x Maleic Acid Buffer (Roche, 115857262001) with 0.3% TWEEN 20 for 30 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total nucleic acids were purified from nasopharyngeal swab samples using a MagNA Pure 96 System (Roche Applied Sciences). All samples were treated with DNase I (Promega ...
-
bioRxiv - Plant Biology 2023Quote: ... Hybridization and probe detection was performed using a DIG Luminescent Detection Kit for Nucleic Acids (Roche Diagnostics, UK) as per the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: ... Nucleic acids were UV-crosslinked to the membrane and incubated with prehybridization buffer DIG Easy Hyb (11603558001, Roche,) in a hybridization tube at 37° C for 30 min with rotation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nucleic acid precipitation was carried on ice in HisA supplemented with 1M LiCl and cOmplete protease inhibitor (Roche) for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nucleic acid pellet was resuspended TE buffer and treated with 0.05 µg/µL RNase (Roche Cat# 11119915001) for >15 hr at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... they were purified in large volume columns using the High Pure Viral Nucleic Acid Large Volume Kit (Roche) with 2.5 mL of PB buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 90 mM KCl, 2 mM EDTA, 0.5 mM EGTA, 10% Glycerol, 2 mM DTT, and 1x complete protease inhibitors Roche) was added ...
-
bioRxiv - Developmental Biology 2021Quote: ... the embryos are rinsed in TBS/0.1% Tween-20 (TBST) then blocked for 2 h in 2% blocking solution (Roche) and incubated O/N in the same solution containing 1:2,500 anti-digoxigenin antibody (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... cells were lysed in 100μL or 200μl of 2% SDS lysis buffer (2% SDS, 50mM Tris-HCl pH 7.5, 5mM EDTA, 15U/mL DnaseI (Roche), cOmplete mini EDTA-free protease inhibitor tablet (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... Real-time PCR assay targeting the virus of interest (see primers/probe sets in Table 7) was performed in a final volume of 12 µL using the LightCycler® 480 Probe Master Mix 1X (Roche Applied Science, Germany), with primers and probes at 200 nM and 2 µL of control DNA ...
-
bioRxiv - Neuroscience 2022Quote: ... The coding sequence of full-length hnRNP R was then PCR-amplified from the cDNA using the KAPA HiFi HotStart ReadyMix (Roche) and sub-cloned into pJET1.2 using the CloneJET PCR Cloning Kit (Thermo Fisher Scientific) ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... The quantity of WSSV genome copies was measured by absolute q-PCR using the primers of WSSV-F/R and a TaqMan fluorogenic probe named TaqMan probe-WSSV via LightCycler TaqMan Master kit (Roche) as described previously (Supplementary Table S2 ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science, Mannheim, Germany) at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... Fractions were supplemented with SDS (to a final concentration of 1%) and then digested with proteinase K (Roche, final concentration of 2 µg/ml) for 45 min at 42 C ...
-
bioRxiv - Cell Biology 2024Quote: ... a final concentration of 1 ng/μl cDNA was mixed with 2 μl FastStart DNA Master SYBR Green I (Roche #03 003 230 001), 0.5 μM forward and reverse primer ...
-
bioRxiv - Biochemistry 2023Quote: ... and were resuspended in 30 mL lysis buffer 1 (50 mM sodium phosphate, 300 mM NaCl, pH 8) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension three times through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Genetics 2023Quote: ... 30 mM Tris-HCl, 20 mM KCl, 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 150 mM NaCl, cOmplete proteinase inhibitor [Roche Diagnostics, Indianapolis, IN, USA]), lysed by ultrasonic treatment and incubated with EZview anti-HA agarose beads (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... Signals were developed using 4-nitro blue tetrazolium chloride (NBT, Roche) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.25% Triton supplemented with protease inhibitor at 4□°C (Roche, 04693159001) for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 mM MgSO4) containing Complete Inhibitor Protease Cocktail (Roche, Indianapolis, IN), lysozyme and DNAse ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C overnight and subsequently developed with NBT/BCIP (Roche). For FISH ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 complete-EDTA protease-inhibitor tablets per 500 mL (Roche). After thawing ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA (4 ng) and LightCycler 480 SYBR Green I Master (Roche) in a final volume of 10 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... 4% BlockAce (DS Pharma Biomedical) and 0.5× Blocking reagent (Roche Diagnostics)] for 1 hr at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Immunohistochemistry was performed on 4 μm sections using the BenchmarkUltra (Roche), anti-hCD45 (M0701 ...
-
bioRxiv - Neuroscience 2024Quote: ... and detection with 4-Nitro blue tetrazolium chloride (NBT; 11383213001, Roche) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Genetics 2021Quote: ... each sample was amplified in 6/2 PCR reactions (2 µg DNA/reaction) in the primary/secondary screens using the ReadyMix Kapa polymerase (Roche) with a total of 20 cycles and an annealing temperature of 55°C (Primer sequences in Table S4 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2×106 cells HEK293T cells were transfected with 2 μg plasmid DNA using X-tremeGENE HP DNA Transfection Reagent (Roche) in 10-cm dishes ...
-
bioRxiv - Immunology 2023Quote: ... dissociated from the coverslips in 8 M urea lysis buffer (100 mM NaCl, 25 mM Tris, 2% SDS, 0.1% tween 20, 2 mM EDTA, 0.2 mM PMSF, and 1x Roche cOmpleteProtease inhibitor). Lysates were treated with benzonase (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... The parasites were pelleted by centrifugation at 25,000 x g and resuspended in 5 × the pellet volume with hypotonic lysis buffer (1 mM HEPES-NaOH pH 7.4, 2 mM EGTA, 2 mM DTT with protease inhibitor cocktail; cOmplete™, EDTA-free, Roche). The parasite suspension was incubated for 10 min on ice and then lysed by approximately 30 passages through a 1mL syringe fitted with a 27G needle.
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Physiology 2021Quote: ... Trypsin activity was then inhibited by adding to the homogenate bovine serum albumin (BSA) fatty acid free (0.25 mg/mL) and protease inhibitor cocktail (PIC, Roche).
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...