Labshake search
Citations for Roche :
1401 - 1450 of 9230 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Embryos were suspended in 1 ml lysis buffer containing a protease inhibitor cocktail (Roche) supplemented with 1 mM phenylmethylsulfonyl fluoride and lysed by sonication ...
-
bioRxiv - Microbiology 2023Quote: ... 1 ml fraction was pelleted and resuspended in EDTA-free protease inhibitor cocktail (Roche), lysostaphin (12.5 μg) ...
-
bioRxiv - Immunology 2023Quote: ... cut into 1-2mm pieces before incubating tissue in 42.4μg/ml Liberase (#5401119001, Roche) and 0.02 mg/ml DNase I for 45 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... cut in 1 mm2 pieces and incubated with 0,05 mg/ml Liberase TH (Roche) for 6-8 minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ml fractions were collected into tubes containing EDTA-free protease inhibitor (11873580001, Roche) at a flow rate of 0.3 ml min−1.
-
bioRxiv - Molecular Biology 2023Quote: ... 20% v/v glycerol) supplemented with 1 tablet / 50 ml Complete protease inhibitor (Roche), 1 mM PMSF) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed in 1 ml of lysis buffer with Complete protease inhibitor (Roche). Lysates were passed through a 27 G needle ...
-
bioRxiv - Cell Biology 2023Quote: ... productively edited cells were selected with 0.3 mg mL-1 hygromycin B (Roche, 10843555001). Homozygously edited clones were identified using the same genotyping strategy as described above and cells which efficiently depleted WAPL were identified using confocal microscopy and Western blotting ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 20 µg mL-1 luciferase reagent (ATP Bioluminescence Assay Kit CLS-II, Roche). The reaction was initiated with 200 µM NADH ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 ml per 2.5×107 cells) supplemented by EDTA-free complete protease inhibitor (Roche). Lysate was prepared by three cycles of freeze-thawing ...
-
bioRxiv - Molecular Biology 2023Quote: ... and protease inhibitor (1 pill per 10 ml; cOmplete Mini EDTA-free, Roche Diagnostics). The lysates were sonicated and then centrifuged at 14,000 x g for 10 minutes at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Lumenal Act PBMCs were activated with Phytohemagglutinin-M 10 µg ml−1 (Roche, Indiana), with cell concentration maintained at 2,000 cells μl−1.
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 ml per 2.5×107 cells) supplemented by EDTA-free complete protease inhibitor (Roche). Lysate was prepared by three cycles of freeze-thawing ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.25 units mL-1 of benzonase and protease inhibitor mix (cOmplete EDTA free, Roche). Cells were lysed using the EmulsiFlex-C5 (15,000 psi ...
-
bioRxiv - Bioengineering 2024Quote: ... minced and dissociated using 1 mg/mL solution collagenase/dispase (Roche, 10269638001 and 11097113001) for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.3% Triton X-100 (Roche), in PBS buffer
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 100 µl solubilisation solution (Roche) was applied per well and plates incubated at 37°C (5% CO2 ...
-
bioRxiv - Biophysics 2019Quote: ... and 100 mM NADPH (Roche). Calcium was selected instead of magnesium to stabilize the metabolite ...
-
bioRxiv - Biochemistry 2019Quote: ... 100 μg proteinase K (Roche), 44 ul of 5M LiCl ...
-
bioRxiv - Genetics 2023Quote: ... 100 µg proteinase K (Roche), 44 ul of 5M LiCl ...
-
bioRxiv - Microbiology 2023Quote: ... and 100 U DNaseI (Roche). The samples were incubated on a 200-rpm shaker at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 µg proteinase K (Roche), 44 µL of 5M LiCl ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1% Triton X-100 (Roche), 1.6 U Recombinant RNase Inhibitor (Takara ...
-
bioRxiv - Physiology 2022Quote: ... This was followed by a perfusion at 4 mL/min for 40 min with the same solution containing 1 mg/mL of collagenase A (Roche Diagnostics GmbH, Mannheim, Germany) plus 300 µM ethylene glycol tetraacetic acid (EGTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM MgCl2, 1% Triton X-100, 50 mM HEPES pH 7.4, 1 x Protease Inhibitor Cocktail [04693159001, Roche Diagnostics], 50 mM NaF, 0.2 mM Na3VO4). The protein concentration was determined by BCA assay (23225 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 150 mM NaCl, 2 mM MgCl2, 1% Triton X-100, 50 mM HEPES pH 7.4, 1 × Protease Inhibitor Cocktail [04693159001, Roche Diagnostics], 50 mM NaF, 0.2 mM Na3VO4). The remaining (87% ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM sodium molybdate) and protease inhibitors (1 mini-Complete EDTA-free tablet per 10 ml lysis buffer; Roche Life Sciences)) and sonicated three times for 15 sec each with intermittent cooling on ice ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM sodium molybdate) and protease inhibitors (1 mini-Complete EDTA-free tablet per 10 ml lysis buffer; Roche Life Sciences)) and sonicated three times for 15 sec each with intermittent cooling on ice ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were re-suspended in 1 mL lysis buffer (5 mM EDTA, 1% NP-40 in PBS) supplemented with 2X cOmplete™ inhibitor (Roche) and were sonicated until the lysate became turbid ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM sodium molybdate) and protease inhibitors (1 mini-Complete EDTA-free tablet per 10 ml lysis buffer; Roche Life Sciences)) and sonicated three times for 15 seconds each with intermittent cooling on ice ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were washed twice in 1□ml Digitonin Buffer (20 mM HEPES-KOH pH 7.5; 150□mM NaCl; 0.5□mM Spermidine; 1×Roche cOmpleteTM; 0.05% digitonin), and then resuspended with CUTANA pAG-MNase in 50□μl Digitonin Buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... 25 million cells were resuspended in 1 ml lysis buffer (1% SDS, 50 mM Tris-HCl pH 8, 20 mM EDTA, 1x cOmplete (Roche, 4693132001) protease inhibitor) ...
-
bioRxiv - Genetics 2023Quote: ... 25-30 million cells were resuspended in 1 mL lysis buffer (1% SDS, 50 mM Tris-HCl pH 8, 20 mM EDTA, 1x cOmplete (Roche, 4693132001) protease inhibitor) ...
-
bioRxiv - Genomics 2024Quote: The nuclei were resuspended in 250 µL of 5’ phosphorylation master mix (1X T4 PNK buffer, 500 U/mL of T4PNK, 1 mM ATP, 1 U/µL of RNAse inhibitor (Roche, 3335399001)) and incubated at 37°C while rotating at 800 rpm for 1 hour to phosphorylate the 5’ ends of RNA ...