Labshake search
Citations for Roche :
1401 - 1450 of 7151 citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The tonsil and lung were gentleMACS dissociated in 5mL digestion buffer (RPMI + 50U/mL DNase I + 1mg/mL hyaluronidase + 1mg/mL collagenase D (Roche)) and then agitated on a shaker at 220rpm for 45 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting fat pads were rinsed in PBS and minced in ice-cold digestion buffer (7.5 mg/ml Collagenase D (Roche 1108886001), and 4.8 mg/ml Dispase II (Sigma D4693 ...
-
bioRxiv - Cancer Biology 2022Quote: ... genomic (g)DNA was extracted both from primary Irf4−/− tumours as well as FACS-sorted control B220+mIgM- BM fr.A-D cells using the High Pure PCR Template Preparation kit from Roche (11796828001). Integrity of resultant gDNA was confirmed in a 2 % Agarose gel ...
-
bioRxiv - Immunology 2022Quote: ... were placed in 5mL of digest media (RPMI + 50U/mL DNase I + 1mg/mL hyaluronidase + 1mg/mL collagenase D (Roche)) and homogenized in gentleMACS C tubes (Miltenyi Cat#130096334 ...
-
bioRxiv - Immunology 2020Quote: ... mice were perfused with sterile PBS and the right inferior lung lobes were digested at 37°C with 630 µg/ml collagenase D (Roche) and 75 U/ml DNase I (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... cellular pellets were suspended in 10 mL of Buffer 1X supplemented with 2 mM (L+D) 1,4-Dithiothreitol (DTT) and cOmplete™ mini protease inhibitor cocktail (Roche). To avoid overheating and protein denaturation ...
-
bioRxiv - Immunology 2021Quote: ... the dura mater was carefully removed from the brain and then chopped for enzymatic digestion in Hanks’ Balanced Salt Solution (HBSS) containing 15 mg/mL collagenase D (Roche) and 1 mg/mL DNase (Roche ...
-
bioRxiv - Physiology 2020Quote: 1 μg RNA was reverse transcribed into cDNA with Oligo(d)T primers using the Transcriptor First Strand cDNA Synthesis kit (Roche). The qRT-PCR was performed with the LightCycler 480 SYBR Green I Master mix (Roche ...
-
bioRxiv - Immunology 2020Quote: ... Spleens were digested for 30 min at 37°C in digestion buffer [(RPMI 1640 supplemented 0.5 mg/ml collagenase D (Roche; 11088866001) and 10 µg/ml DNase I (Roche ...
-
bioRxiv - Immunology 2022Quote: Excised tumors were cut into small pieces following by incubation 0.5 mg/ml collagenase D (Hoffmann-La Roche, Basel, Switzerland), 10 µg/ml DNAse I (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: Spleen from C57BL/6J mice were mechanically disrupted using the back-end of a syringe before addition of 50 μL 11x concentrated collagenase D (Roche, #11088866001 ...
-
bioRxiv - Immunology 2023Quote: ... in a plate and mechanically disrupted using the back-end of a syringe before addition of 50 μL of a digestion media (dRPMI = naRPMI supplemented with 11x collagenase D (#11088866001, Roche, Woerden ...
-
bioRxiv - Immunology 2023Quote: ... Kidneys were homogenized using the Miltenyi gentleMACS Dissociator and digested for 20 minutes at 37°C in RPMI with 2 mg/mL collagenase D (Roche) and 0.1 mg/mL DNAse I ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 mL dissociation buffer (RPMI-1640 (Cytiva) with 25 mM HEPES and 10 µg/mL gentamicin sulfate) supplemented with 2 mg/mL Collagenase-D (Roche) and 100 U DNaseI (Roche) ...
-
bioRxiv - Immunology 2023Quote: Lungs were perfused with sterile PBS and the left lobes of the lungs were digested at 37°C with 630 µg/ml collagenase D (Roche) and 75 U/ml DNase I (Sigma) ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out in 12 μL volumes containing 6 μL of High Resolution Melting Master (Roche Applied Science, Germany), 0.24 μL of each 10 μM primer ...
-
bioRxiv - Cell Biology 2020Quote: C2 myoblasts were transfected 18-24 h after plating at 70-80% confluence by using FuGENE 6 (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Resulting cell pellets were resuspended in Buffer A (100 mM NaH2PO4, 10 mM Tris, 6 M GuHCl, 10 mM imidazole) + PIC (Roche 05056489001). Cells were sonicated 3X at 25% power for 10s (Cole-Parmer GE 130PB-1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were added and after an additional 6 hours BrdU was added and a cell proliferation assay was performed according to the manufacturer’s instructions (Roche Applied Sciences).
-
bioRxiv - Cell Biology 2021Quote: ... cells transfected with a combination of RCAS plasmids (RCAS PDGFB-HA, RCAS shp53-RFP) using the FuGENE 6 transfection kit (Roche, 11814443001) according to the manufacturer’s protocol and as previously described 86 ...
-
bioRxiv - Microbiology 2022Quote: Mice were fasted for 6 h and baseline blood glucose levels were measured with an Accu-Check Performa blood glucose meter (Roche, USA) using blood collected from the tail vein ...
-
bioRxiv - Immunology 2019Quote: ... Each reaction consisted of a total amount of 12 µL divided into 6 µL LightCycler 480 SYBR Green I Master (Roche Diagnostics), 2 µL primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragments were separated on 0.7% agarose gels buffered with 40 mM Tris-acetate at 4V/cm for 6 h and transferred overnight to nylon membranes (Roche, Switzerland) by alkaline transfer ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.6 mL of incubation buffer (citric acid 100 mM and NaCl 250 mM pH 5.5 with inhibitor cocktail (Roche, Rotkreuz, Switzerland) dilution according to the instructions of the manufacturer) ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Plant Biology 2019Quote: ... 4% (w/v) polyvinylpyrrolidone) supplemented with 2x protease inhibitor cocktail without EDTA (#11873580001, Roche) for 1 h at 4°C in an Eppendorf ThermoMixer at 2000 rpm ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated overnight at 4 °C in MABB with anti-fluorescein POD (Roche) at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2019Quote: ... Signals were developed using a mixture of 4-Nitro blue tetrazolium chloride (Roche, 11383213001) and BCIP 4-toluidine salt solution (Roche ...
-
bioRxiv - Genetics 2021Quote: ... followed by addition of 5 µl of 4 µg/mL DNase-free RNase (Roche). Samples were loaded onto 96-well Qiacube-HT® columns and DNA was purified using a Blood & Tissue kit (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mutants were extracted with PBS containing 4 mM digitonin and protease inhibitors (Roche).
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then incubated overnight at 4°C with an anti-GFP (ROCHE Anti-GFP ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DTT and 10 % (v/v) glycerol) supplemented with: cOmplete protease inhibitor (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4 °C in MABB with anti-DIG POD (Roche) at a 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was reverse-transcribed using 2.5×10-4 U/μl hexanucleotide mix (Roche), 0.4mM deoxynucleotide mix (Sigma-Aldrich) ...