Labshake search
Citations for Roche :
1651 - 1700 of 7151 citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Brains of ICR mice mock- infected or infected ocularly with 3×106 PFU/eye of vUNG-S302A and vUNG-SA-repair were homogenized in TriPure isolation reagent (Roche) using a disposable pestle system (Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: 100 pmol gapmers (Supplemental Table S4) were labeled with biotin-16-ddUTP (Jena) and a 2nd generation DIG-oligonucleotide 3’end-labeling kit (Roche) using the manufacturer’s protocol or with radioactive labeling mix (1 µL 10x PNK buffer ...
-
bioRxiv - Microbiology 2023Quote: Wildtype genes were amplified by PCR from JE2 genomic DNA using the primers shown in Table 3 and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC226 using KpnI and SacI restriction sites and T4 DNA ligase (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or MRTX849 for 3 hours prior to protein isolation with RIPA buffer containing 1x cOmpleted EDTA free protease inhibitor (Roche) and 1x phosSTOP (Roche) ...
-
Impact of light pollution at night on male reproductive success in Japanese medaka (Oryzias latipes)bioRxiv - Zoology 2023Quote: ... Each cDNA sample was measured in duplicate using 3 μL of 4x diluted cDNA per 10 μL reaction in a LightCycler96 Instrument (Roche). qPCR parameters were set to 10 minutes of preincubation at 95 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting cDNAs were amplified with primers DP3 and DP5 (5’-GTTCAGAGTTCTACAGTCCGACGATC-3’, 0.5 μM) and KAPA Hifi HotStart DNA polymerase (Roche, KK2601) to the optimal amplification point ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were diluted 1:10 in water and qPCR was performed with 3 μL of each diluted cell lysate using the LightCycler 480 Probes Master mix (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 mM NaCl, 20 mM Imidazole pH 7.5, 3 mM MgCl2, 100 µM EDTA, 5 mM β-Mercapoethanol, 20 µM GDP, Roche cOmplete protease inhibitor cocktail and DNAse I ...
-
bioRxiv - Developmental Biology 2023Quote: ... dissected hindbrains were fixed in 4% PFA for 1 hour (and stored up to 3 months) and stained as previously described (Myat et al., 1996) using a digoxygenin-labelled riboprobe (Roche) against the target mRNA sequence (Table 3) ...
-
bioRxiv - Bioengineering 2024Quote: All qPCR reactions were carried out using 384-well plates in 3 technical replicates in 10 µl final reaction volume on the LightCycler 480 System II (Roche). Reaction mix consisted of Power Track SYBR Green Master Mix 2X ...
-
bioRxiv - Molecular Biology 2023Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Developmental Biology 2023Quote: ... Positive controls were generated by incubating some sections from control 3 dpf animals with recombinant DNAse I (400 U/ml; Roche) for 20 minutes at room temperature before the incubation in the reaction mix ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate; Roche) until the staining appeared (overnight or up to 48 h) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Immunology 2023Quote: Single cell suspensions of whole lungs were lysed with Laemmli buffer (10% glycerol, 3% SDS, 10 mM Na2HPO4) with protease inhibitor cocktail (Roche). Proteins were separated on a 12% SDS-PAGE gel and electro transferred onto PVDF membranes ...
-
bioRxiv - Developmental Biology 2024Quote: Primary tissue samples from reduction mammoplasties of healthy women were dissociated through a 3 mg/mL collagenase (Roche Life Science) solution and sorted via density gradient ...
-
bioRxiv - Plant Biology 2022Quote: ... 200 mM NaCl, 1 mM EDTA, 1%NP-40, 1 mM DTT, 10 mM MgCl2, 1 × protease inhibitor cocktail from Roche) for 2 h at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.1% SDS,1% NP-40 and 1% Triton X-100) supplemented with 1 mM PMSF and protease inhibitor cocktail (Roche) at 4°C for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM NaF, 1 mM Na3VO4, 1 mM PMSF, protease inhibitor cocktail [1 tablet in 50 mL lysis buffer, Roche]). The whole cell extract was denatured ...
-
bioRxiv - Molecular Biology 2019Quote: ... The membrane was incubated overnight (O/N) at 4°C with mouse anti-α-tubulin (Roche, loading control) at 1:4000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... in an equal volume of lysis buffer (30 mM HEPES/KOH pH 7.4, 100 mM KCl, 1.5 mM MgCl2, 0.1% Triton X-100, Protease Inhibitor Cocktail Tablets, EDTA-free, Roche Rnase inhibitor ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were then probed overnight at 4℃ in anti-GFP (mouse monoclonal IgG1κ, cat#: 11814460001 Millipore Sigma/Roche) diluted 1:1000 in 5% Applichem nonfat dried milk in TBS-T ...
-
bioRxiv - Cell Biology 2022Quote: ... before being detached with 40 μL of ice-cold native lysis buffer (80 mM PIPES pH 6.9, 2 mM MgCl2, 4 mM EGTA, 0.2% saponin, 5x cOmplete protease inhibitor cocktail Roche). The lysate was collected in 1.5 mL tube and incubated on ice for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Neuroscience 2020Quote: ... with 0.34 mg/ml nitroblue tetrazolium (NBT) and 0.35 mg/ml 5-bromo-4-chloro-3indolyl-phosphate (BCIP; Roche), for 1–12 hours at room temperature with gentle agitation ...
-
bioRxiv - Cell Biology 2019Quote: ... washed with PBS and resuspended in lysis buffer (0.5% Triton X-100, 4% w/v SDS, 0.5xPBS) supplemented with protease inhibitor cocktail (Roche). 5xSDS-PAGE loading buffer containing 25 mM dithiothreitol was added to the lysates ...
-
bioRxiv - Cell Biology 2021Quote: ... was homogenized and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and chromatin was extracted overnight at 4°C in 0.5X PBS (67.5 mM NaCl) with a protease inhibitor cocktail (Roche) on an end-over-end rotator ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections on slides were post-fixed at 4% PFA in 0.1M PB and treated with proteinase K (Roche). Sections were hybridized with digoxigenin (DIG)-labeled probes at 72°C overnight in hybridization solution ...
-
bioRxiv - Physiology 2023Quote: ... Tissues were chopped with scissors and digested in a cocktail containing 4 units/mL LiberaseTM (Roche; Catalog# 355374) and 0.744 units/mL Elastase (Worthington Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µl cDNA and 5 µl of LightCycler 480 SYBR Green I Master mix (Roche Diagnostics GmbH, Germany). Three technical replicates of each sample were included ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM EGTA and 1 mM dithiothreitol) with 1% protease inhibitor cocktail (04693116001, Roche) and diluted 1x with the 2x loading buffer (65.8 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 uL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-PARP1 1:1000 (1 835 238 Roche), anti-tubulin 1:5000 (B-5-1-2 Santa Cruz) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP (mouse, Roche AB_390913, Substrate 1:1); anti-actin (mouse ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... HA-HRP (Roche, 12013819001, 1:1,000-1:5,000), MPP6 (Atlas antibodies ...
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biochemistry 2019Quote: ... and the resulting duplex was captured on 3 mg streptavidin-coated magnetic beads (Roche, rotation for 2 h at 37°C). After extraction with phenol-chloroform and precipitation with ethanol ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...