Labshake search
Citations for Roche :
1401 - 1450 of 8506 citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Cultured cells were lysed on ice through repeated pipetting in 2% SDS supplemented with Protease Inhibitor Cocktail (Roche) and PhosStop phosphatase inhibitor (Roche) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Blocking was performed in MAB blocking buffer (100 mM Maleic acid, 150 mM NaCl, 2% Blocking reagent [Roche, 1096176] ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA (2 µl) was added to the mixture with FastStart SYBR Green Master Mix kit (Roche, Basel, Switzerland) and specific primers SP_F 5’-GAC-CAG-TCG-AAC-GCA-CAT-TG-3’ and SP_R 5’-CGG-AGA-GGG-TTG-TTG-TGT-CT-3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... whereas the pellet (insoluble fraction) was resuspended in 2% SDS/TBS supplemented with protease inhibitor cocktail (Roche, Switzerland), 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... Glomus cells were dissociated using a mixture of collagenase P (2 mg/ml; Roche Applied Science, Indianapolis, IN), DNase (15 μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... Digestion was performed for 30 min at 37⍰C with 2 mg/ml collagenase D (Roche, Meylan, France), 1 mg/ml dispase (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl RNA were incubated for 10 min at room temperature with 0.6 µg baker’s yeast tRNAPhe (Roche), 1 mM MgCl2 and increasing amounts of protein in a volume of 20 µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tumor tissue was mechanically dissociated into 2-4mm pieces and then digested in 2.5 mg/mL Liberase and 0.1 mg/mL DNase (Roche) for 1 hour at 37C ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... constructs in 6:3:1 weight ratios by X-Treme Gene HP Transfection Reagent (Roche) or the calcium phosphate method ...
-
bioRxiv - Neuroscience 2021Quote: ... 100 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 5% glycerol, and 0.1% Triton X-100 supplemented with Roche Protease Inhibitor cocktail) and then roc ked for 10 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: 12-16 hours old embryos were collected and lysed in homogenization buffer (25 mM Hepes pH 7.4; 150mM NaCl; 0.5mM EDTA pH 8.0; 1 mM DTT and 1 tablet of proteinase inhibitor cocktail; Roche 11836170001). The aqueous phase of the lysate was collected after 1 hour of centrifugation at 4°C and centrifuged again for 25 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted by combining phenol-chloroform–isopropanol treatment using the High Pure RNA Isolation Kit (Roche, Germany) (101) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 mM Tris-HCl pH 8.0, 5% glycerol, 1 mM DTT, 0.1% CHAPS, 1 μg/mL avidin, cOmplete, EDTA-free protease inhibitors [Roche]), rotated at 4°C for 30 min ...
-
bioRxiv - Genomics 2024Quote: ... Cell lysis was carried out by resuspending cells in complete LB1 (50 mM Hepes pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100, 1 × Roche cOmplete Mini (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... lysates were incubated at 4 °C overnight with rabbit anti-GFP (1:1000, Roche) and pull down was performed with magnetic proteinA beads (Millipore ...
-
bioRxiv - Genomics 2024Quote: ... and incubated overnight at 4°C with Anti-Dig-AP antibody (Roche, 1:5000) in 1% lamb serum ...
-
bioRxiv - Biochemistry 2024Quote: ... tissues were lysed in RIPA buffer (ratio 1:4) supplemented with protease inhibitors (Roche) and protein was quantified by BCA Protein Assay Kit assay.
-
bioRxiv - Developmental Biology 2024Quote: ... 4 h in 1:1500 solution of anti-digoxigenin antibody (Roche, cat no. 11333089001):blocking solution ...
-
bioRxiv - Genetics 2024Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Physiology 2022Quote: ... 5 mM MgCl2 and 1 mM PMSF) supplemented with Protease Inhibitor Cocktail (Roche), 1 mM DTT ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol) containing 1× complete EDTA-free protease inhibitor cocktail (Roche 1187358001) and lysed in an Emulsiflex-C5 cell disruptor (Avestin) ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.6 with KOH) containing 5 mg ml−1 collagenase (type A, ROCHE). Defolliculated oocytes were injected with 50 ng mRNAs of mixed GlyT1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... media was replicated by a 5% solution of WST-1 reagent (Roche, 11644807001) in media ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 mM Tris/HCl pH 7.4/50 mM NaF, 10 mM Na4P2O7, 2 mM MgCl2 and Complete Mini, EDTA-free protease inhibitor [Roche]). Lysates were cleared and incubated with GFP-Trap agarose beads for 60 min ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS and 50 mM DTT with the addition of anti-protease (cOmplete cocktail, Roche 11 873 588 001). Samples were boiled 5 min at 95°C before loading on polyacrylamide gels ...
-
bioRxiv - Cell Biology 2020Quote: ... Monoclonal (3F10) antibody directed against the HA epitope and monoclonal (B-2) antibody against GFP were purchased from Roche and Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-μl aliquots of all cDNA samples were analyzed in triplicate on 96-well optical PCR plates (Roche Diagnostics). GAPDH or TBP was used as the reference gene and all analyses were performed using the ΔΔCt method with Roche LightCycler 96 system software ...
-
bioRxiv - Neuroscience 2022Quote: ... DRGs from E13.5 embryos were dissected and placed in droplets of 2 mg/ml collagen (Roche Diagnostic, catalog#11179179001) together with COS1 aggregates transfected with either secreted Myc-Sema3A or control PAY1-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA probes were incubated for 2 hours at 37 degrees with Dig RNA labeling mix (11277073910, Roche, Basel, Switzerland) and SP6 or T7 RNA polymerase (RPOLSP6-RO and RPOLT7-RO ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of PCR gene specific primer (10X conc) (Table S1) and 10 μl of master mix (Roche 04707516001) in 20 μl reaction ...
-
bioRxiv - Genomics 2020Quote: ... the pellets were washed with ice-cold nuclei suspension buffer (1X PBS containing 2% BSA and 0.2 U/µl Protector RNase Inhibitor, ROCHE) and filtered through a 30μm cell strainer (Fisher Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
bioRxiv - Immunology 2021Quote: ... Lungs were dissected and digested for 30min at 37°C using RPMI media (2% FBS+ Pen/Strep, glutamine, 10mM HEPES) containing 0.5mg/mL Collagenase D (Roche). The digested fragments were passed through a 70μm cell strainer (Greiner bio-one ...
-
bioRxiv - Cancer Biology 2021Quote: Human tumor samples were collected on different days right after surgery and digested in Hank’s Balanced Salt Solution supplemented with 2 mg/mL collagenase A (Roche), 2.5 U/mL hyaluronidase (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in ice-cold homogenizing buffer (20 mM HEPES pH 7.4, 250 mM sucrose, 2 mM MgCl2, and EDTA-free protease inhibitor cocktail [Roche]), and homogenized on ice by 25 passages through a 26-guage needle fitted to a 1 mL syringe ...
-
bioRxiv - Immunology 2020Quote: ... The red blood cell layer was lysed with 2 mL of Red Blood Cell Lysis Buffer (Cat# 11814389001, Roche) in a 15 mL tube ...
-
bioRxiv - Biophysics 2020Quote: ... N2A cells were transfected with 1.0 μg of a cDNA construct and 2 μL of X-tremeGENE HP DNA transfection reagent (Roche Diagnostics GmbH ...
-
bioRxiv - Cell Biology 2021Quote: To isolate mammary epithelial cells the third and fourth pairs of mammary glands were removed from 4 to 6-week-old s-SHIP–GFP transgenic (Tg11.5kb–GFP) mice, minced with scissors and digested in digestion medium (DMEM/F12, 2 mg ml−1collagenase I (Roche), 5 mg ml−1 insulin (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were isolated by adding SDS lysis buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol) supplemented with protease inhibitor cocktail (PIC; Roche). DNA was sheared by sonication for 10 min at high settings (30 s on ...
-
bioRxiv - Cell Biology 2020Quote: ... were resuspended in 1x sample buffer (0.5 x TBE, 10% glycerol, 2% SDS) supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail (5 mM sodium fluoride ...
-
bioRxiv - Plant Biology 2020Quote: ... Cell pellets from 200 mL of Chlamydomonas culture were resuspended in an extraction buffer (20 mM HEPES pH= 7.5, 20 mM KCl, 10% glycerol, 2× EDTA-free protease inhibitor mix (ROCHE)) ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 mM Tris pH 7.4, 20 mM EDTA, 10 mM NaF, 2 mM benzamidin and protease inhibitor cocktail [Roche]), and centrifuged 3 min at 5000 rpm ...
-
bioRxiv - Neuroscience 2020Quote: ... the small intestines were cut into 2-5mm2 pieces and put into digestion solution (0.75mg/ml Liberase TH Research Grade (Roche), 12 U/ml Dispase ...
-
bioRxiv - Biophysics 2022Quote: ... For cell lysis the cells were resuspended in 4 mL per g pellet in lysis buffer (20 mM Tris/HCl pH 7.5, 150 mM NaCl, 2 mM MgCl2, Protease Inhibitor (ROCHE), spatula DNAseI ...