Labshake search
Citations for Roche :
1251 - 1300 of 8506 citations for 2 5 Sulfanyl 4H 1 2 4 triazol 3 yl phenol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested and resuspended in 2 ml of 1X PBS containing protease inhibitor cocktail (Roche) and 500μl of resuspended cells was taken as a control for uncrosslinked sample (referred to as -DSG in the text) ...
-
bioRxiv - Microbiology 2020Quote: ... but tested negative on the day of sampling (cobas® SARS-CoV-2 test, Roche diagnostics), and from a healthy individual ...
-
bioRxiv - Neuroscience 2020Quote: ... All the PCR reactions were carried out with Kapa HiFi 2 x mastermix (KK2601, Kapa Biosystems). PCR products were then separated by 2% agarose gel ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µg of each plasmid was combined with Fugene transfection reagent (Roche Applied Science, Mannheim, Germany) at a ratio of 5 µl of transfection reagent to 1 µg DNA in 500 µl of MEM and incubated at room temperature for 30 minutes prior to addition to a 10 cm dish of HEK293 cells at 50% confluence ...
-
bioRxiv - Microbiology 2020Quote: ... CD4+ T cells and B cells were activated for 48h with 10U/ml IL-2 (Roche) and 2 μg/ml phytohemagglutinin (PHA ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2% Triton X-100) supplemented with the Roche complete protease inhibitor cocktail (Roche; catalog #: 4693159001). The homogenates were centrifuged at 800 × g for 10 min at 4 °C ...
-
bioRxiv - Systems Biology 2021Quote: ... for 2 hours followed by overnight digestion with 1.5 mg/ml collagenase B (Roche Diagnostics, Switzerland) in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Developmental Biology 2020Quote: ... hind limbs were harvested and incubated with 2 Wunsch units of Liberase TM (Sigma/Roche 5401127001) in 2ml Ca2+ ...
-
bioRxiv - Molecular Biology 2022Quote: ... The clarified lysate was incubated with 2 mL of pre-equilibrated Protein C affinity resin (Roche) for 3 h at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 mM DTT) supplemented with one tablet cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) and 1 mg/ml lysozyme ...
-
bioRxiv - Cell Biology 2022Quote: ... the retinas were sonicated in 200 μL of 2% SDS containing protease inhibitor mixture (eComplete; Roche) in PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... fixed in 2% PFA diluted in HM supplemented with PhosSTOP (04906837001 Roche, one tablet/10 ml) for 15 hours at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNasin 400 U/ml and RVC 2 mM) supplemented with protease inhibitor (complete EDTA free, Roche). 60 μL of equilibrated Dynabeads Protein G (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1% sodium dodecyl sulfate) supplemented with 2% v/v protease inhibitor cocktail (Roche; Catalog #11697498001) and 1% v/v phosphatase inhibitor cocktail (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... D-Mel (d.mel-2) cells were transfected using X-tremeGene HP DNA transfection reagent (#06366236001, Roche). Two days after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were cultivated in the presence of IL-2 (10 IU/mL, Roche, Basel, Switzerland). Three days after coinfection cells were sorted based on expression of mouse CD48 and mCD24 (BD biosciences ...
-
Extrusion fountains are hallmarks of chromosome organization emerging upon zygotic genome activationbioRxiv - Molecular Biology 2023Quote: 400-600 embryos were homogenized in 2 ml 0.5 % Danieau’s with protease inhibitor cocktail (PIC, Roche) and 1 % (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... 2% Triton X-100) containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche cOmplete, Sigma Aldrich)] ...
-
bioRxiv - Pathology 2023Quote: ... The digestion was stopped with 2 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitors (Complete-TM, Roche) followed by centrifugation at 18,000 x g for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were then washed in 0.2x SSC and MBST before blocking with 2% blocking solution (Roche) for at least 1 hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... CD4+ T cells were cultured in RPMI + IL-2 (final concentration 100 U/mL, Roche, 10799068001), IL-7 (final conc ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was incubated with 2 ml of pre-equilibrated Protein C affinity resin (Roche) for 2h at 4°C ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5-2 M of urea (depending on the construct) and one protease inhibitor cocktail tablet (Roche). Following sonication on ice (10 min at 40 % power ...
-
bioRxiv - Biophysics 2024Quote: Colony PCR reactions were then performed as follows: 2 µL of KAPA HiFi HotStart ReadyMix (Roche) was assembled with 0.8 µL of 1:10 bacteria dilution ...
-
bioRxiv - Microbiology 2021Quote: ... 3 mM DTT and 1 mM PMSF) supplemented with protease inhibitor cocktail (Roche). Zirconium beads equivalent to 100 µL volume was added in microcentrifuge tubes and resuspended cells were lysed by 6 rounds of bead beating on a bullet blender ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Genetics 2024Quote: ... in 300-Wash Buffer (1 mL 1M HEPES pH 7.5, 3 mL 5M NaCl, 12.5 µL 2M spermidine, and 1 Roche c0mplete Protease Inhibitor EDTA-free tablet with ddH2O to 50 mL ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM ß-glycerophosphate, 5 mM NaF, 1 mM Na3VO4) and protease inhibitors (Roche cOmplete ULTRA Tablets, EDTA-free). The lysates were sonicated on ice (4x 10s bursts ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Neuroscience 2024Quote: ... specific digoxigenin (DIG)-labeled RNA probes and performed nitro blue tetrazolium (NBT)/ 5-bromo-4-chloro-3-indolyl-phosphate color-reaction (BCIP) after wash and incubation with anti-digoxigenin antibody (catalog. no. 11093274910; Roche; RRID: AB_514497) as previously reported (Zempo et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol) containing 1× complete EDTA-free protease inhibitor cocktail (Roche). Insoluble debris was removed by centrifugation at 15000 rpm for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatants were diluted 1:4 with ice-cold dilution buffer (1× phos-stop [Roche], 0.5% NP-40, 1 mM DTT) and centrifuged again at 15,000 rpm for 15 minutes at 4°C to precipitate actomyosin components ...
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... Incubation of primary antibodies was performed overnight at 4 °C in 5% non-fat dry milk or 3.5% BSA (Roche, 10735086001). After three washes in PBS-T ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using phenol-chloroform extraction method and 40 μg of glycogen (Roche cat. no. 10901393001) was mixed with the aqueous phase ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested and incubated in buffer A (50 mM MMT pH 8.0/300 mM KCl/10 mM MgCl2/5 % glycerol) containing 1 g L-1 lysozyme/2.5 U mL-1/SmDNAse//complete protease inhibitor cocktail (Roche) for 1 h prior to lysis using EmulsiFlex C5 (Avestin ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 150 mM NaCl, 2% w/v PVPP, 10 mM DTT, 1× tablet of cOmplete™, EDTA-free Protease Inhibitor Cocktail [Roche], 0.1% Tween 20 [Sigma] per 50 ml), centrifuged at 4200 × g at 4°C for 20–30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.05M Tris HCl pH 7.9, 5μM MgCl2, 5μM CaCl2, 2% SDS supplemented with 1x protease inhibitor cocktail, ROCHE) by sonication on ice ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM imidazole and 2 mM β-mercaptoethanol) supplemented with DNaseI (AppliChem) and Complete Protease inhibitor (Roche). After one passage through a French press cell ...