Labshake search
Citations for Roche :
1351 - 1400 of 2408 citations for 4 Phenyl 3 buten 2 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). Glut-1 (2B scientist ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell pellets were lysed in 2% SDS buffer supplemented with complete Protease (Roche, 11697498001) and PhosSTOP phosphatase (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... Cobas TaqMan RealTime HIV-1 (version 1 or 2; Hoffmann-La Roche, Basel, Switzerland) or the Abbott RealTime HIV-1 assay (Abbot Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Coverslips were blocked in 3% BSA (wt/vol) and digoxigenin was detected with sheep anti-digoxigenin FITC 1/50 (Roche, 11207741910) followed by rabbit anti–sheep FITC 1/100 (Vector Laboratories ...
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Molecular Biology 2024Quote: ... beads were collected using a magnet stand at 4 °C and washed 3 times with beads wash buffer (sperm dilution buffer supplemented 1x cOmplete EDTA-free protease inhibitor cocktail (Roche, # 4693132001), 1x PhosSTOP (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were in vitro transcribed from the linearized vector for 3 hours at 37°C with the corresponding RNA polymerase and DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel and diluted in hybridization solution for further use ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Genetics 2024Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: Cryosections (10μM) of ventricular tissue were fixed in 4% paraformaldehyde and stained with In-situ Cell Death Detection kit (Roche). Sections were imaged on a laser-scanning confocal microscope (LSM 510 ...
-
bioRxiv - Cell Biology 2020Quote: ... Magnetic beads were washed 2 times with lysis buffer and 4 times with washing buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mg/ml Pefabloc SC (Roche), and EDTA-free protease inhibitor cocktail (cOmplete Tablets ...
-
bioRxiv - Genetics 2021Quote: ... Then they were incubated overnight at 4°C with primary antibodies diluted in a dilution buffer (0.5% blocking reagent (Roche), 2% fetal bovine serum ...
-
bioRxiv - Developmental Biology 2020Quote: ... the embryos were washed and equilibrated in NTMT buffer followed by coloration with 4-nitro blue tetrazolium (NBT, Roche) and 5-Bromo-4chloro-3-indolyl-phosphate ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 1 h and then incubated overnight at 4 °C in block solution with diluted DIG-antibodies (1:5,000) conjugated with alkaline phosphatase (AP) (Roche). To visualize WISH signal ...
-
bioRxiv - Immunology 2021Quote: Mouse tracheal epithelial cells were isolated from tracheas digested overnight at 4 °C in Ham’s F12 medium plus pronase (1 mg/ml; Roche). Cells were cultured for 3 h on Primaria plates (Falcon ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Plant Biology 2020Quote: ... roots were incubated overnight at 4°C in anti-myc-mouse primary antibody (1:250, Roche in blocking solution), washed 3 times in PBST ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 were purified according to the instructions of the manufacturer using the High Pure PCR Template Preparation Kit (Roche) followed by RNAse A digest and a final purification with the High Pure PCR Product Purification Kit (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... qPCR reactions were performed in 10 μl reactions containing 4 μl of LightCycler 480 SYBR Green I Master (Roche), 4 μl of PCR-grade water (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... The PBS was aspirated and 1 ml of homogenization buffer (320 mM sucrose, 4 mM HEPES NaOH, pH 7.4) supplemented with cOmplete EDTA-free protease inhibitor (Roche) and 1 mM ATP NaOH ...
-
bioRxiv - Neuroscience 2019Quote: ... the pellet was re-suspended in SDS lysis buffer (137 mM Tris-HCl pH 6.8, 4% SDS, 20% Glycerol, Proteinase inhibitor, Roche), sonicated and quantified using the Pierce BCA Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
Toxoplasma GRA15 limits parasite growth in IFNγ-activated fibroblasts through TRAF ubiquitin ligasesbioRxiv - Immunology 2020Quote: ... The membrane was blotted overnight at 4°C with rat antibody against the HA tag (Roche, 1/500 dilution), TRAF2 and TRAF6 rabbit antibodies (Suppl ...
-
bioRxiv - Neuroscience 2019Quote: ... some TK rats (n=11) were orally administered 4 mg of valganciclovir (val) to reduce neurogenesis (Hoffman La-Roche; delivered in 0.5 g peanut butter + chow pellets ...
-
bioRxiv - Molecular Biology 2019Quote: Cells were collected after two cold PBS washes by scraping in 2X SDS Lysis Buffer (4% SDS, 20% Glycerol, 120mM Tris-Cl pH 6.8, 1x protease (Roche) and phosphatase inhibitors (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2019Quote: ... 4 million cells were seeded in a 10 cm cell culture dish for transfection using X-tremegene 9 (Roche) and Opti-MEM (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... cell pellets were lysed in 4% SDS/100 mM Tris HCl pH 7.4 supplemented with cOmplete protease inhibitor cocktail (Roche), and sonicated at 4 °C using a Diagenode Bioruptor ...
-
bioRxiv - Developmental Biology 2021Quote: ... WB following 4-20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) employed HRP-conjugated anti-HA antibody (Roche). Quantification was performed by Image J software.
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight at 4°C in B1 buffer with alkaline phosphatase-conjugated anti-DIG (1/2000; Roche 11633716001). After three washes in B1 buffer and one wash in B3 buffer (100 mM Tris–HCl pH 9 ...
-
bioRxiv - Genomics 2021Quote: ... These cells were re-suspended in lysis buffer (4% SDS, 50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 100 mM NaCl) with Protease inhibitor (Roche) and RNase inhibitor ...