Labshake search
Citations for Roche :
1601 - 1650 of 2408 citations for 4 Phenyl 3 buten 2 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... The remaining fragments were then treated with a collagenase/dispase mixture (2 mg/mL final) (Roche) and DNase I (2 mg/mL final ...
-
bioRxiv - Genomics 2020Quote: ... contaminating genomic DNA was removed by incubating with 2 µl of RNase-free DNase I (Roche) for 30 min at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... with both basic (Cell Conditioner 1) and mildly acidic (Cell Conditioner 2) antigen retrieval methods (Roche, Ventana Medical Systems ...
-
bioRxiv - Biophysics 2019Quote: ... (5) motor solution consisting of 2 μM biotinylated KIF1A in motor dilution buffer (1mM ATP [Roche] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of sample was mixed with 10 µL 2X SYBR Mix (Kapa Biosystems, Wilmington, MA), 0.4 µL of each 10 µM primer (IDT ...
-
bioRxiv - Microbiology 2021Quote: ... spanning the SARS-CoV-2 genome) were purified using Kapa HyperPure beads (Roche Molecular Systems Inc) and quantified using a Qubit fluorometer and dsDNA HS Assay Kit (Thermo Fisher Inc ...
-
bioRxiv - Pathology 2021Quote: ... Lymph node samples then had 2 µl of 500 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µg of RNA was reverse-transcribed with Transcriptor First Strand cDNA synthesis Kit (Roche, www.roche.com). The A ...
-
bioRxiv - Microbiology 2021Quote: ... DS6350 chromosomal DNA was used as a template and Expand polymerase with Expand Buffer 2 (Roche). The resulting PCR fragment was purified using the QIAquick PCR purification kit (Qiagen ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested and resuspended in 2 ml of 1X PBS containing protease inhibitor cocktail (Roche) and 500μl of resuspended cells was taken as a control for uncrosslinked sample (referred to as -DSG in the text) ...
-
bioRxiv - Microbiology 2020Quote: ... but tested negative on the day of sampling (cobas® SARS-CoV-2 test, Roche diagnostics), and from a healthy individual ...
-
bioRxiv - Neuroscience 2020Quote: ... All the PCR reactions were carried out with Kapa HiFi 2 x mastermix (KK2601, Kapa Biosystems). PCR products were then separated by 2% agarose gel ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µg of each plasmid was combined with Fugene transfection reagent (Roche Applied Science, Mannheim, Germany) at a ratio of 5 µl of transfection reagent to 1 µg DNA in 500 µl of MEM and incubated at room temperature for 30 minutes prior to addition to a 10 cm dish of HEK293 cells at 50% confluence ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM MgCl2) supplemented with 1% Triton-X100 and a mini complete protease inhibitor pill (Roche). Lysates were centrifuged at 20,000 × g for 15 min at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... CD4+ T cells and B cells were activated for 48h with 10U/ml IL-2 (Roche) and 2 μg/ml phytohemagglutinin (PHA ...
-
bioRxiv - Immunology 2019Quote: For the in vitro cell stimulation and maintenance reagents were as follows: human IL-2 (Roche); IL-21 (PeproTech) ...
-
bioRxiv - Developmental Biology 2022Quote: ... rinsed 2 times for 5 minutes with alkaline phosphatase buffer and stained with NBT/BCIP (Roche) as described previously (Kraus et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2% Triton X-100) supplemented with the Roche complete protease inhibitor cocktail (Roche; catalog #: 4693159001). The homogenates were centrifuged at 800 × g for 10 min at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Systems Biology 2021Quote: ... for 2 hours followed by overnight digestion with 1.5 mg/ml collagenase B (Roche Diagnostics, Switzerland) in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Developmental Biology 2020Quote: ... hind limbs were harvested and incubated with 2 Wunsch units of Liberase TM (Sigma/Roche 5401127001) in 2ml Ca2+ ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% Triton X-100 and 2 mM phenylmethylsulfonyl fluoride and Complete Protease Inhibitor cocktail (Roche Diagnostics). 2 µg of the extracted proteins were separated by SDS-PAGE gel and stained with CBB R-250 ...
-
bioRxiv - Microbiology 2019Quote: ... Glutamax and Pen/Strep and with 100 U/mL recombinant human IL-2 (Roche; Sigma # 10799068001). For the analysis of reverse transcription products ...
-
bioRxiv - Neuroscience 2022Quote: ... the bill-skin preparation was treated for 5 minutes with 2 mg/mL collagenase P (Roche) in Krebs solution containing (in mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... The clarified lysate was incubated with 2 mL of pre-equilibrated Protein C affinity resin (Roche) for 3 h at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT) supplemented with 0.3 mg.mL-1 lysozyme and EDTA-free protease inhibitor cocktail (Roche) prior to pressure-assisted lysis using a French press system ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 mM DTT) supplemented with one tablet cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) and 1 mg/ml lysozyme ...
-
bioRxiv - Biophysics 2022Quote: ... 2 mM β-ME) supplemented with 5 μM pepstatin A and complete protease inhibitor tablets (Roche). All purification steps were carried out at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... the retinas were sonicated in 200 μL of 2% SDS containing protease inhibitor mixture (eComplete; Roche) in PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... fixed in 2% PFA diluted in HM supplemented with PhosSTOP (04906837001 Roche, one tablet/10 ml) for 15 hours at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNasin 400 U/ml and RVC 2 mM) supplemented with protease inhibitor (complete EDTA free, Roche). 60 μL of equilibrated Dynabeads Protein G (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... D-Mel (d.mel-2) cells were transfected using X-tremeGene HP DNA transfection reagent (#06366236001, Roche). Two days after transfection ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1% sodium dodecyl sulfate) supplemented with 2% v/v protease inhibitor cocktail (Roche; Catalog #11697498001) and 1% v/v phosphatase inhibitor cocktail (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were cultivated in the presence of IL-2 (10 IU/mL, Roche, Basel, Switzerland). Three days after coinfection cells were sorted based on expression of mouse CD48 and mCD24 (BD biosciences ...
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
Extrusion fountains are hallmarks of chromosome organization emerging upon zygotic genome activationbioRxiv - Molecular Biology 2023Quote: 400-600 embryos were homogenized in 2 ml 0.5 % Danieau’s with protease inhibitor cocktail (PIC, Roche) and 1 % (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... 2% Triton X-100) containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche cOmplete, Sigma Aldrich)] ...
-
Single-cell analysis of shared signatures and transcriptional diversity during zebrafish developmentbioRxiv - Developmental Biology 2023Quote: ... animals in PBST were rocked in 2% blocking buffer (5 g of blocking reagent, Roche, 11096176001) in 1X maleate buffer (150mM maleic acid ...
-
bioRxiv - Pathology 2023Quote: ... The digestion was stopped with 2 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitors (Complete-TM, Roche) followed by centrifugation at 18,000 x g for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were then washed in 0.2x SSC and MBST before blocking with 2% blocking solution (Roche) for at least 1 hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... CD4+ T cells were cultured in RPMI + IL-2 (final concentration 100 U/mL, Roche, 10799068001), IL-7 (final conc ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was incubated with 2 ml of pre-equilibrated Protein C affinity resin (Roche) for 2h at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Collected media was incubated for 2 hours at 55°C with 20mg/ml proteinase K (Roche). Then ...
-
bioRxiv - Biochemistry 2024Quote: ... End point cell proliferation was assayed with ELISA 5-bromo-2′ -deoxyuridine (BrdU) kit from Roche Diagnostics (Sigma– Aldrich) ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5-2 M of urea (depending on the construct) and one protease inhibitor cocktail tablet (Roche). Following sonication on ice (10 min at 40 % power ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml taxol, 3 U/ml DNAse I, 10 μg/ml RNAse A, 1 U/ml micrococcal nuclease, and Roche Complete Protease Inhibitors) and vortexed vigorously for 1 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...