Labshake search
Citations for Roche :
1301 - 1350 of 6394 citations for Fipronil Sulfone 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... membranes were blocked in 5% BSA (BSA Fraction V; Roche Life Sciences, Almere, The Netherlands) in TBS-T or 5% milk in TBS-T for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Molecular Biology 2019Quote: ... 1.5 μl DNA Pol Mix (5 U/μl, Expand Long Template PCR System, Roche Diagnostics), 27.25 μl PCR HPLC Gradient Grade H2O and 1 μl template (primary WTA product) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 2ME [pH 7.5]) supplemented with protease and phosphatase inhibitors (Roche, Indianapolis, IN) for 20 minutes on ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM EDTA) and freshly added PMSF (1 mM) and Protease Inhibitor Cocktail (Roche #11836170001). Equal amounts of protein (30 μg ...
-
bioRxiv - Cell Biology 2019Quote: ... ATP 5 mM) supplemented with proteases and phosphatase inhibitors (cOmplete EDTA-free and PhosSTOP, Roche). Cells were homogenized in a ball homogenizer with 10 μm clearance ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 mM beta-mercaptoethanol (BME)) with protease inhibitors (cOmplete™ EDTA-free, Roche, Indianapolis, IN). Lysozyme (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Biophysics 2020Quote: ... 5 mM MgCl2 (buffer B) containing 2 mM PMSF and Complete protease inhibitor cocktail (Roche). After centrifugation ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then blocked in PBT 0.2% with 5% bovine serum albumin (Roche, Cat# 10735094001) before staining with primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and immunoprecipitated with 5 μg Mouse monoclonal anti-GFP antibody (clone 9E10, IgG, Roche, Switzerland). About 200∼300 bp of ChIP DNA and input DNA were recovered and dissolved in water for further qPCR analysis [82] ...
-
bioRxiv - Plant Biology 2022Quote: ... The 5’-end biotin probes were generated using a DIG Gel Shift Kit (Roche, China) (Supplemental Table S8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA pH 8.0) supplemented with protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche, 11697498001) and lysed by vortexing at 4 °C for 15 minutes.™ Cell debris was pelleted by spinning at 21000 RCF at 4 °C for 15 minutes and protein containing supernatant was taken ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5×106 K562 cells were resuspended in PBS with EDTA-free protease inhibitor cocktail (Roche) and lysed using a 27.5G needle ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM MgCl2 and 0.25 M sucrose) supplemented with a protease inhibitor cocktail tablet (Roche). Successively ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA containing EEEb1 was labeled with cyanine-5-dUTP by Nick Translation Mix (Roche), while plasmid DNA harboring each of the other nine DNA families (EEEb2–EEEb10 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStar Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
Planarians employ diverse and dynamic stem cell microenvironments to support whole-body regenerationbioRxiv - Developmental Biology 2023Quote: ... Samples were blocked in MABT containing 5% horse serum and 1% Western Blocking Reagent (Roche). In situ signals were developed as previously reported ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA diluted 1:5 in water was quantified using either SYBR Green I (Roche, # 04707516001) and a LightCycler 480 (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media was aspirated and minced tissue was digested with ∼5 mg of Collagenase P (Roche) in 5 mL cold HBSS for 15-20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM TCEP and 5 % glycerol) supplemented with cOmplete EDTA-free protease inhibitor complex (Roche) and ribonuclease A (Roche) ...
-
bioRxiv - Cancer Biology 2021Quote: ... For the RNase and DNase treatment 100 μg/ml RNase mix (Roche) or 100 U/ml DNase I (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 μg/mL cycloheximide) supplemented with protease cocktail inhibitor EDTA-free (Roche). Lysates were clarified by centrifugation (10000g ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 μg/mL cycloheximide) supplemented with protease cocktail inhibitor EDTA-free (Roche) on ice for 20 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 μg/mL DNase I (grade II from bovine pancreas, Roche). Frozen worms were lysed in a coffee grinder (Krups ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 μg/mL Aprotinin+Protease inhibitor cocktail (Roche # 11 836 153 001). Proteins were separated by SDS-PAGE ...
-
bioRxiv - Genomics 2020Quote: ... 100 μg/ml cycloheximide and 1× Protease-Inhibitor Cocktail EDTA-free (Roche)) ...
-
bioRxiv - Cell Biology 2021Quote: ... cut into pieces and digested using 100 μg/ml Collagenase P (Roche), 800 μg/ml Dispase II (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 μg/ml cycloheximide) supplemented with Complete Protease and Phosphatase inhibitors (Roche), and 2000 U/ml RNaseOUT™ (ThermoFisher) ...
-
bioRxiv - Biophysics 2020Quote: ... one flow cell volume of 100 μg/ml anti-digoxigenin (Roche, Switzerland) in 1x PBS is introduced ...
-
bioRxiv - Immunology 2022Quote: ... freshly supplemented immediately before with 100 mg/mL of Liberase TM (Roche) and 100 μg/mL of DNase I (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μg/mL cycloheximide and 1× Protease-Inhibitor Cocktail EDTA-free (Roche)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DNAse I from bovine pancreas (100 μg/mL; Roche, Cat. #: 10104159001). A final digestion with 0.25% Trypsin-EDTA solution was performed for single cell dissociation ...
-
bioRxiv - Cancer Biology 2022Quote: ... and stained with a solution of 100 μg/ml RNase (#10109142001, Roche) and 50 μg/ml propidium iodide (#P4170 ...
-
bioRxiv - Biochemistry 2021Quote: ... one tablet per 100 mL of buffer (Complete, EDTA 2%, Roche Diagnostics)) was performed ...
-
bioRxiv - Biochemistry 2021Quote: ... one tablet per 100 mL of buffer (Complete, EDTA 2%, Roche Diagnostics). Regarding the purification of ZO-1-PDZ2 ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 µl starch degradation mix (16.8 units ml-1 amyloglucosidase [#10102857001; Roche, Mannheim ...
-
bioRxiv - Cell Biology 2022Quote: ... Fragments were dissociated in 1:100 Liberase™ (2.5mg/mL, Roche 5401135001) in CMFB at 30°C ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μg/ml cycloheximide and 1× Protease-Inhibitor Cocktail EDTA-free (Roche)) ...
-
bioRxiv - Cell Biology 2023Quote: ... at 100 U/mL) or Thrombin vehicle (0.1% BSA (Roche Cat# 10735086001) in PBS ...
-
bioRxiv - Cancer Biology 2021Quote: The in vitro synthesis of digoxigenin (DIG)-labeled antisense SatIII probe (158 bp SatIII repeat cloned in 1μg of PGEM-2-98 construct) with T7 RNA polymerase was carried out using the DIG labeling kit from Roche Products Pvt ...
-
bioRxiv - Cell Biology 2020Quote: ... 1ml of digestion solution (TM Liberase at 4 units/mL (Roche, Basel, Switzerland) and DNAse Type I at 800 units/mL (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 200 μl/ml of a 4% stock solution of blocking reagent (Roche 11096176001) which was dissolved and autoclaved in MNT solution (150 mM maleic acid pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... Macrophages were polarized with 20 ng/mL recombinant IL-4 (Peprotech or Roche) or 100 ng/mL LPS (E ...
-
bioRxiv - Cell Biology 2022Quote: ... MEFs were incubated for 4 h with 10 ng/ml colcemid (Roche, 10295892001). Cells were then collected and incubated for 15 min at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 14 ml lysis buffer (100 μg/ml Lysozyme, 1 % Triton, 1 mM PMSF, 1 x protease inhibitor (cOmplete, Roche), 10 mM DT ...
-
bioRxiv - Cell Biology 2020Quote: ... Pelleted tissue was weighted and resuspended in the enzymatic digestion mix composed by 2,4 U/ml dispase II (4 ml/g of muscles) (Roche 04942078001) dissolved in Dulbecco’s phosphate buffered saline (D-PBS ...