Labshake search
Citations for Roche :
1251 - 1300 of 8575 citations for N 2 Chloro 5 1 oxo 2 3 pentadecylphenoxy butyl amino phenyl 4 4 dimethyl 3 oxovaleramide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: Cells were lysed in 200 μL lysis buffer (50 mM HEPES pH 8.0, 2% SDS, 1 mM PMSF, cOmplete Protease Inhibitor Cocktail, Roche), heated to 99 °C for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resin was washed five times with 10 CV of Amylose Buffer (30 mM HEPES pH 7.6, 0.3 M NaCl, 0.1% CHAPS, 0.25 mM EDTA, 2 mM DTT, 10% glycerol, 1× Roche cOmplete protease inhibitors). Protein was eluted with Amylose Buffer supplemented with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2024Quote: ... SDS (0.2%), Triton X-100 (2%), sodium deoxycholate (1%), Tris HCl (100 mM, pH 8.0)) with protease inhibitor (Roche #11836145001), then incubated on ice for 30 m ...
-
bioRxiv - Microbiology 2024Quote: ... Broncholalveolar lavage (BAL) fluids were obtained by intratracheal injection of 2 × 1 ml PBS supplemented with protease inhibitors (Roche). Serum was collected by intracardiac puncture and separated from whole blood in Z-Gel microtubes (Sarstedt) ...
-
bioRxiv - Immunology 2024Quote: ... and incubated on ice for 1 hour and washed thrice with Buffer 2 (0.05% w/v Saponin, 1X Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Biochemistry 2024Quote: ... and pellets were resuspended in lysis buffer (25 mM Tris-HCl, pH 8.0, 300 mM NaCl, 0.5 mM TCEP, 1× Benzonase, 2× protease inhibitor cocktail [Roche cOmplete]). The cells were lysed using a cell disruptor at 1.5 kbar ...
-
bioRxiv - Biochemistry 2024Quote: ... resuspended in lysis buffer (25 mM Tris-HCl, pH 8.0, 300 mM NaCl, 0.5 mM TCEP, 1× Benzonase, 2× protease inhibitor cocktail [Roche cOmplete]), and lysed using a cell disruptor at 1.5 kbar ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification with 21 cycles was conducted by adding 3 µL KAPA HiFi HotStart ReadyMix (Roche) and 0.05 µL IS PCR primer (10 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg gDNA of each population was amplified using the KAPA HiFi ReadyMix PCR Kit (Roche) with the TKO outer Fw and Rv primers (Primers are listed in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... with their respective dilution in 5% skimmed milk in PBS-tween 0.1% were used: anti-HA-HRP (3F10) (N°12013819001, Roche) 1/10,000 ...
-
bioRxiv - Genomics 2020Quote: ... Note that this exome capture kit generates much less discordantly mapped read pairs than the kit from Roche (2 versus 22, compare with Figure 2). Accordingly ...
-
bioRxiv - Genomics 2022Quote: ... Positivity of SARS-CoV-2 infection was assessed both by PCR and measurement of specific antibodies (Cobas-Roche using Elecsys Anti-SARS-CoV-2 S). All patients gave their consent for participation in this study ...
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Plant Biology 2021Quote: ... pH 7.4) for 30 min and subsequently incubated 1 h with anti-HA-peroxidase high-affinity monoclonal rat antibody (3F10; Roche [catalog no. 12013819001]) diluted 1:1000 in 2.5% (w/v ...
-
bioRxiv - Biochemistry 2020Quote: ... the expression medium containing the secreted fusion protein was supplemented with 1/4 tablet of protease inhibitor (complete EDTA-free protease inhibitor cocktail tablets, Roche Diagnostic GmbH, 45148300) and transferred to a 15 ml Falcon tube containing 200 μl of washed ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated overnight at 4 °C in MABB with anti-fluorescein POD (Roche) at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mutants were extracted with PBS containing 4 mM digitonin and protease inhibitors (Roche).
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then incubated overnight at 4°C with an anti-GFP (ROCHE Anti-GFP ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DTT and 10 % (v/v) glycerol) supplemented with: cOmplete protease inhibitor (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4 °C in MABB with anti-DIG POD (Roche) at a 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was reverse-transcribed using 2.5×10-4 U/μl hexanucleotide mix (Roche), 0.4mM deoxynucleotide mix (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested with digestion buffer (Gibco DMEM/F12, Fisher 11320033; 4 µg/ml Roche Collagenase/Dispase ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were blocked in blocking buffer comprised of 4% Bovine Serum Albumin (Roche, 10735087001) and 1% Triton X-100 in 1X PBS for 30 minutes at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg.kg-1 midazolam (Dormicum, Roche), and 0.05 mg.kg-1 fentanyl (Fentanyl ...
-
bioRxiv - Biophysics 2023Quote: ... solubilized with 1 % final concentration n-Dodecyl β-D-maltoside (Roche, Mannheim, Germany) and incubated for 5 min at 25 °C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Sections were blocked for 1 h with 2% blocking reagent in MABT (Perkin-Elmer) and then incubated with anti-digoxigenin-POD (Roche), diluted 1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5% (v/v) glycerol and 1 mM Tris(2-carboxy-ethyl) phosphine (TCEP) containing an EDTA-free protease inhibitor tablet (Roche). The cell suspension was sonicated on ice and clarified by centrifugation at 27,000g for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... in DMEM medium supplemented with Glutamax and 10 % FBS were transfected using a 2:1 ratio X-treme GENE HP DNA transfection reagent (Roche) per μg of plasmid DNA with a total of 0.5 μg DNA per well ...
-
bioRxiv - Cell Biology 2021Quote: ... 150 mM KOAc, 2 mM MgCl2, 1 mM CaCl2, 0.2 M sorbitol, 10mM PMSF, 2x protease inhibitor cocktails [Roche, 11873580001]), dropped into liquid nitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transposed chromatin was amplified using customized Nextera PCR Primer 1 and Primer 2 (barcode) (31) and HotStart KAPA ReadyMix (Roche). Libraries were quantified by Qubit using the DS DNA HS kit (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... The cells were washed with PBS and crosslinked for 30 min in 2 ml ice cold 1% formaldehyde containing 2X Complete EDTA-free Protease Inhibitor Cocktail (Roche). Cross-linking was stopped by the addition of glycine to 333 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... One mL of yeast lysate (1-2 mg/mL) prepared in column buffer freshly supplemented with protease and DUB inhibitors (cOmplete mini EDTA-free (Roche), 10 mM NEM ...
-
bioRxiv - Neuroscience 2021Quote: ... there is a need to stop it after 2 hours by a single injection of diazepam (Valium®, 10 mg×kg−1, i.p.; Roche). Rats were then hydrated with 2 mL of saline solution (0.9% NaCl ...
-
bioRxiv - Neuroscience 2020Quote: ... 18 µl cleared cell lysate or brain homogenates (20-100 µg based on Tau aggregate content) were incubated with 2 µl 1 mg / ml pronase (Roche) at 37° C for one hour ...
-
bioRxiv - Cell Biology 2022Quote: ... Each DNA sample was diluted to 1 ng/μL and 2 μL were used for amplification using PrimeTime Gene expression Master Mix (IDT) with LightCycler96 (Roche) instrument ...
-
bioRxiv - Immunology 2022Quote: ... and spleen were harvested and homogenated in PBS for CFU counting or in isotonic buffer (Tris HCl 50 nM, EDTA 2 mM, PMSF 1 mM [Roche Diagnostics GmbH] ...