Labshake search
Citations for Roche :
1051 - 1100 of 8575 citations for N 2 Chloro 5 1 oxo 2 3 pentadecylphenoxy butyl amino phenyl 4 4 dimethyl 3 oxovaleramide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM MgCl2 with Protease Inhibitor Cocktail (Roche) and clarified by centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM benzamidine and a protease inhibitor cocktail (Roche), and cleared by centrifugation ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM 1,10-phenanthroline) containing protease inhibitor (Roche,#4693159001). The homogenates were centrifuged at 100,000 g ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 200 U/ml of IL-2 (Roche) and 50 U/ml of penicillin/streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... with 100 μl DNase I (2 mg/ml, Roche) in a 37 °C incubator shaking orbitally for 30 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mg/mL protease inhibitor mixture (Roche Diagnostics)) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 μL of 25× protease inhibitor cocktail (Roche, #4693159001), 1 μL of 50 mM biotin ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 mg/ml protease inhibitor mixture (Roche Diagnostics) and samples prepared ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin-2 (20U/ml; Hoffmann-La Roche). Fresh medium containing IL-2 was added twice per week ...
-
bioRxiv - Cell Biology 2021Quote: ... and protease inhibitors (2 complete EDTA-free pellets (Roche)/50 ml buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... blocked in blocking buffer with 2% Blocking Reagent (Roche), 20% goat serum in MABT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM PMSF and phosphatase inhibitor cocktail (PhosSTOP; Roche). For the analysis of RAN translation after cellular stress induction ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... and human recombinant IL-2 (30 U/ml, Roche) for 72 h.
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM EDTA) with protease inhibitor cocktail (Roche, Switzerland) and manually homogenized on ice ...
-
bioRxiv - Developmental Biology 2023Quote: ... 12.5 μL KAPA HiFi Hot-Start ReadyMix (2×, Roche); sterile water ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM ATP) containing phosphatase inhibitor (PhosphoStop, Roche Diagnostics) as described previously (19) ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 mM EDTA) supplemented with Protease Inhibitor (Roche,11836170001) and homogenized with ∼60 gentle strokes ...
-
bioRxiv - Genetics 2023Quote: ... KAPA HiFi HotStart PCR Ready Mix (2×) (Roche, KK2601) was used as polymerase for all the PCR amplification steps in this paper ...
-
bioRxiv - Pathology 2023Quote: ... 2 mg/mL Dispase II (Roche Applied Biosciences, 4942078001), BSA Fraction V (Fisher Scientific ...
-
Activation of XBP1s attenuates disease severity in models of proteotoxic Charcot-Marie-Tooth type 1BbioRxiv - Neuroscience 2024Quote: ... 2% SDS) containing protease inhibitor cocktail (PIC 100X, Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM sodium orthovanadate and protease inhibitors (Roche, #1697498)] was used to homogenize the brain samples ...
-
bioRxiv - Immunology 2024Quote: ... collagenase P 2 mg/mL (Roche, Mannheim, Germany, #11213857001), then carefully removed ...
-
bioRxiv - Systems Biology 2023Quote: ... and digested with collagenase D (2 mg/ml; Roche) in RPM 1640 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... using 2× Lightcycler 480 probes master (Roche, Indianapolis, IN) for IPO8 and Maxima SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Immunology 2023Quote: ... and 10 ng/ml recombinant human IL-2 (Roche). For activation of murine CD4+ T cells ...
-
bioRxiv - Microbiology 2023Quote: ... 2× KAPA HiFi HotStart DNA Polymerase ReadyMix (Roche, Switzerland), and 0.5 μM for each of the forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... 2× KAPA HiFi HotStart DNA Polymerase ReadyMix (Roche, Switzerland), and 0.2 μM for each of the forward and reverse primers ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... sections were incubated with 2% NBT/BCIP solution (Roche) in darkness at 4 °C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were blocked with 2% blocking reagent (Roche) and 5% normal goat serum in MAB for 30 min at RT and incubated with alkaline phosphatase-conjugated anti-DIG antibody (1:10000 for oxt ...
-
bioRxiv - Developmental Biology 2024Quote: ... the specimens were blocked with 2% blocking reagent (Roche) in maleic acid buffer [100 mM maleic acid ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 % (v/v) glycerol and protease inhibitor cocktail (Roche Complete protease inhibitor cocktail ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM DTT) supplemented with protease inhibitor cocktail (Roche) and Benzonase (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... 2×KAPA HiFi Hotstart polymerase (KAPA Biosystems, Wilmington, MA), 0.2 μM forward primer ...
-
bioRxiv - Biochemistry 2024Quote: ... 10% glycerol) supplemented with 2 protease inhibitor tablets (Roche) and 2 mM PMSF ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR (qPCR) with 2× SYBR green dye (Roche) on a LightCycler 480 (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μl of 2 X TaqMan Master Mix (Roche), 0,1 μM TaqMan LNA probe and 0,1 μM of each primer ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled tissue from each brain region was suspended in 6 ml of 0.32 M sucrose homogenization buffer (4 mM HEPES, 0.1 mM CaCl2, 1 mM MgCl2, plus Roche protease inhibitor tablet) and homogenized with a Teflon homogenizer using 10 strokes at 900 rpm ...
-
bioRxiv - Plant Biology 2021Quote: ... The digested DNA was separated in a 1 % agarose gel at 50 Volts for 72 hours at 4°C and transferred to a nylon membrane (Roche®) overnight ...
-
bioRxiv - Biophysics 2022Quote: ... embryos were washed (4 X 10 min) in PBTx and blocked in PBT-B (1× PBS, 20% (v/v) western blocking reagent (Roche, 11921673001), 2 mM ribonucleoside vanadyl complex (NEB ...
-
bioRxiv - Pathology 2020Quote: ... Coverslips were incubated overnight at 4 °C with a 1:100 dilution with one of the following primary antibodies: HA (Roche, #867423001), KDEL (Abcam ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... for 3-4 hours at room temperature followed by overnight incubation at 4°C in anti-DIG-AP Fab fragments (1:5000) (Roche 1093274). Embryos were washed with PBST followed by an alkaline tris buffer ...
-
bioRxiv - Cancer Biology 2022Quote: Engineered monoallelic cell pellets (500 million cells/sample) were lysed at 4°C in 1% CHAPS (Roche Diagnostics, cat no. 10810126001) lysis buffer (pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then incubated overnight at 4°C with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche #11093274910) in MABT blocking buffer with 1% sheep serum ...
-
bioRxiv - Molecular Biology 2022Quote: ... The supernatant was then discarded and the pellet was resuspended in 300 µL SDS buffer (4 % SDS, 10 mM EDTA, 25 mM TrisHCl pH 7.5, 1 mM PMSF, 1x Roche protease inhibitor) and incubated at room temp (10 minutes) ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at room temperature and incubated with an appropriate antibody overnight at 4°C: 1:3000 anti-DIG-AP (Roche 11093274910), 1:1000 anti-DIG-POD (Roche 11207733910 ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stained with secondary antibodies (1:300) for 2 hours at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). The cells were mounted using the ProLong Diamond antifade mountant (Thermo ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were stained with secondary antibodies (1:300) for 2 h at room temperature and nuclei stained with DAPI (1:1000, Roche, Munich, Germany). Cells were mounted with ProLong Diamond Antifade Mountant (Thermo P36970 ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.