Labshake search
Citations for Roche :
1251 - 1300 of 8226 citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was eluted from the beads by incubation for 1h at RT (while rotating) with 150-250 µl wash buffer supplemented with phosphatase inhibitors (PhosSTOP, Roche) and 0.5 mg/ml 3xFLAG peptide (APExBIO) ...
-
bioRxiv - Microbiology 2019Quote: ... After washing with 1xPBS containing 0.1% v/v Tween-20, PIP–strips were incubated (1h, RT, agitated) with a monoclonal anti-HA antibody (clone 3F10, monoclonal antibody from Roche) at a dilution of 1:500 in blocking buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... SE was stopped after 1H by two injections of Diazepam (Valium) with a 15 min interval (10 mg/kg, i.p. Roche, France). Pilocarpine-treated animals were then observed periodically for general behavior and occurrence of spontaneous seizures ...
-
bioRxiv - Immunology 2022Quote: Mouse’s left lung was cut into pieces and digested for 1h with 10mL of DNAse I (10mg/mL, Roche #10104159001) and type I collagenase (100mg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Microbiology 2019Quote: ... 5 mM 2-mercaptoethanol and 1 × protease inhibitor cocktail (Roche)] ...
-
bioRxiv - Immunology 2019Quote: ... and Cell Death ELISA (Roche, 11774425001, plasma dilution 1:2) which estimates cytoplasmic histone-associated DNA fragments (mono-and oligonucleosomes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 20min on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM β-mercaptoethanol in presence of Dnase 1 (Roche), EDTA-free protease inhibitor coctail (Roche ...
-
bioRxiv - Genetics 2019Quote: ... and 2 μL of RNAse A (Roche 1 119 915) were added and left for one hour at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 1% P/S and 50 U/mL IL-2 (Roche), at 37°C and 5% CO2.
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM benzamidine) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids were transfected in HeLa and YFP-Parkin HeLa using Xtreme Gene 9 (Roche) according to manufacturer’s directions ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3mg or 1mg/ml/kg midazolam (Hypnovel, Roche, diluted with 0/9% w/v saline) fifteen minutes prior to a standard punishment session ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transfected with siRNA oligonucleotides using X-treme GENE 9 DNA Transfection reagents (Roche) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and transfected with 150-300 ng of indicated construct using XtremeGene 9 transfection reagent (Roche) according to the manufacturer’s recommendation ...
-
bioRxiv - Cancer Biology 2021Quote: Transfection of CRISPR/Cas9 constructs was performed using X-tremeGENE 9 DNA Transfection Reagent (Roche), with 4.0 μg plasmid per 200.000 cells/well in a six-well plates ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 10 µg sgRNA plasmid using X-tremeGENE™ 9 DNA transfection reagent (Roche 06365809001). One day after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfections were performed using the X-treme GENE 9 DNA transfection reagent (Roche Applied Science) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... Nup96-GFP KI U2OS cells were transfected using X-tremeGENETM 9 DNA Transfection Reagent (Roche), and 24h after transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were deparaffinized followed by antigen retrieval in CC1 buffer (pH 9, 95°C; Roche), endogenous peroxidase blocking ...
-
Trypanosoma brucei J protein 2 functionally cooperates with the cytosolic Hsp70.4 and Hsp70 proteinsbioRxiv - Molecular Biology 2019Quote: ... The resulting lysate was cleared by centrifugation (13 000 g, 40 min, 4°C) and the supernatant was incubated with cOmplete His-tag purification resin (Roche, Germany) and allowed to bind overnight at 4°C with gentle agitation ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two milligrams recombinant MYC and 12 μl T7-HCF-1VIC were rotated overnight at 4°C in Kischkel buffer + PIC (Roche 05056489001). Anti-FLAG M2 Affinity Gel (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2022Quote: ... following a 30 min incubation at 4 °C in the presence of protease inhibitors (cOmplete™ EDTA-free Protease Inhibitor Cocktail, Roche). Following centrifugation at 16,000 g for 10 min ...
-
bioRxiv - Genetics 2022Quote: ... 10% of cleared lysate was set aside to serve as input samples and the remainder was incubated at 4°C with anti-GFP antibodies (Roche #11814460001) for 3 h under gentle rotation ...
-
bioRxiv - Neuroscience 2019Quote: ... mPFC tissue was incubated overnight at 4°C with an anti-DIG antibody coupled to horseradish peroxidase (Roche, Mississauga, ON, Canada) and mouse monoclonal anti-SMI-32 antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2020Quote: WB was performed on cell lysates obtained by harvesting cells with lysis buffer (Tris 125 mM pH 6.8, 4% sodium dodecyl sulfate, 20% glycerol) with Complete Protease Inhibitor Cocktail (Roche, Basel, Switzerland) and sonicating ...
-
bioRxiv - Genomics 2019Quote: We added UMIs to a total of 4 µg of DNA from each replicate split across eight reactions with KAPA2G Robust HotStart ReadyMix (Kapa Biosystems) for three cycles with a 65 °C annealing and 40 s extension ...
-
bioRxiv - Microbiology 2019Quote: ... 4 μl of the cDNA sample together with 16 μl mastermix were combined and analyzed using a LightCycler Nano (Roche, Germany). The light cycler program was as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Microbiology 2023Quote: ... All steps were performed at 4°C and buffers were all supplemented with protease inhibitor cocktail from Roche (cOmplete tablets, EASYpack). The pellets were washed once in buffer A (50 mM Tris/HCl pH8.0 ...
-
bioRxiv - Immunology 2022Quote: Purified DNA from mouse fecal pellets or sorted cells was subjected to 16S variable region 4 PCR amplification using barcoded 515F and 806R primers (47) and the KAPA2G Robust HotStart ReadyMix (KAPA Biosystems), with the following cycling conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... Each brain with known weight was homogenized at 4°C using automated homogenizer and with IX RIPA buffer containing protease inhibitor tablet (Roche, Germany). After that the brain lysates were centrifuged at 12,000 rpm for 10 mins ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA sequencing (RNA-seq) libraries were prepared from 4 µg of total RNA using the KAPA stranded mRNA-seq kit (Roche, KK8421) according to manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2024Quote: ... assay was performed following our previous publication(4, 55) and the instruction of In Situ Cell Death Detection Kit TMR red (Roche, 12156792910). Cells were cultured on coverslips for 36 h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 30 mM mgCl2 x 6 H2O and 5 mg/mL glucose-6-phosphate dehydrogenase (Roche Diagnostics) in 0.1 M potassium phosphate buffer pH 7.4 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with a total of 1 µg of DNA using Fugene 6 (Roche, Branchburg, NJ) according to the manufacturer’s instructions
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... 350 mM NaCl, 2 mM MgOAc, 1 mM CaCl2, 15% glycerol, 0.1% Triton X-100, 0.05% 2-ME, 1x Roche protease inhibitors ...
-
bioRxiv - Microbiology 2021Quote: ... HindIII treatment was performed at 37°C for 1 h in 1x reaction buffer B with 10U of HindIII enzyme per reaction (HindIII, 10656321001, Roche, Switzerland). Mung bean nuclease treatment was performed at 30°C for 30 min in 1x mung bean nuclease reaction buffer with 1U per reaction (Mung Bean Nuclease ...
-
bioRxiv - Biochemistry 2021Quote: ... 150 mM sodium chloride (NaCl), 20% glycerol, and 1 mM Dithiothreitol (DTT, Scientific) supplemented with one Complete EDTA free protease inhibitor tablet (Roche) per 50 ml lysis buffer ...