Labshake search
Citations for Roche :
1201 - 1250 of 1343 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Pellets of CoREST and LSD1 were resuspended in lysis buffer (50 mM NaH2PO4 pH 8.0, 300 mM NaCl, 5% glycerol, 7.5 mM imidazole supplemented with PMSF, DNAse and EDTA-free Roche protease inhibitor cocktail) in a weight ratio of 1:1.5 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and cell pellets were resuspended in twice their volume of buffer A (50 mM HEPES pH 7.5, 500 mM KCl) with 5 mM MgCl2 and DNase I (Roche, Basel, Switzerland). Cells were lysed by sonication using a SonoplusGM200 (BANDELIN electronic GmbH & Co ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Quantification of specific gene transcripts was achieved through droplet digital PCR (ddPCR) using the Digital LightCycler 5× RNA Master Kit (Roche, swiss) with specific primers and probes ...
-
bioRxiv - Systems Biology 2024Quote: ... equimolar amounts of oligo pool and reverse primer (Supplemental Table 5: Oligo Library cloning R: cttgctatgctgtttccagc) were mixed with 2X KAPA HiFi master mix (Roche, 07958935001) and incubated for 10 min at 72°C ...
-
bioRxiv - Microbiology 2024Quote: Probe was labeled according to the manufacturer instructions with TB40 SV40-GFP BAC DNA (Nick Translation Mix, Roche, 11745808910 and Tetramethyl-Rhodamine-5-dUTP, Roche 11534378910) and prepared for hybridization by combining 0.5mg of each labeled probe and 5mg cot-1 (Invitrogen ...
-
bioRxiv - Systems Biology 2024Quote: ... Transcripts were amplified from 200 ng library product across 5 50-µL PCR reactions with 2x KAPA HiFi Master Mix (Roche, #07958935001), P065-P5 ...
-
bioRxiv - Microbiology 2024Quote: ... 50 µL of the post-nuclear supernatants was saved as the input lysate and 450 µL were incubated with 5 µg of anti-GFP antibody (Roche 11814460001) for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Then tissue was rinsed three times in ice-cold RPMI-1640 and digested in 5 ml of complete media (RPMI-1640 containing 10% FBS, 1% antibiotic/antimycotic, 5mg/ml DNase I) supplemented with 5 mg/mL Liberase™ (Roche) and 5mg/ml DNase I (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2024Quote: ... 1µl each of 100 µM primers Sol-PrimerA (5′-GTTTCCCACTGGAGGATA-N9-3′) and Sol-PrimerB (5′-GTTTCCCACTGGAGGATA-3′) 18 and 0.8 µl Expand High Fidelity enzyme mix (Roche, Basel, Switzerland). Reaction conditions for the PCR were ...
-
bioRxiv - Neuroscience 2024Quote: Fresh frozen brains were weighed and homogenized with 4X w/v HSAIO buffer (50 mM Tris base, 274 mM NaCl, 5 mM KCl, pH 8.0) with protease (Pierce, cat# A32955) and phosphatase (Roche, cat# 04906845001) inhibitors using a motorized mortar and pestle ...
-
bioRxiv - Neuroscience 2024Quote: ... Arterial samples to measure whole blood glucose concentrations were taken every 5-15 minutes and analysed using a handheld blood glucose meter (Accu-Chek® Aviva, Roche) to minimize blood volume sampling ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were finally revealed with NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate) (both from Roche Diagnostics) mixed in B2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 0.1% NP-40, 0.5 mM DTT, 1 mM PMSF, and 1% Roche protease inhibitor cocktail) and rotated for 30 min at 4℃ ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were ground in liquid nitrogen and homogenized in 40 ml of NEB1 buffer (10 mM Tris-HCl [pH 8.0], 0.4 M sucrose, 10 mM MgCl2, 5 mM DTT, 0.1 mM PMSF, 1% Roche protease inhibitor cocktail tablet). The homogenate was filtrated through two layers of Miracloth ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 0.6 to 5 nanograms of enriched DNA was used for library preparation using the Kapa HyperPrep Kit (Roche, Cat. # 07962347001) following EpiCypher’s parameters for indexing PCR and library amplification as described in the CUT&RUN Library Prep Manual ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were blocked with 5% lamb serum diluted in TBST and incubated with an anti-digoxigenin antibody conjugated to Alkaline phosphatase (1/2000, Roche, 11093274910) overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... lysis buffer (50 mM Tris pH 7.5, 50 mM potassium acetate, 5 % v/v glycerol, 0.3 % v/v Triton X-100, Roche complete protease inhibitor)25,27,35 ...
-
bioRxiv - Cell Biology 2024Quote: ... Programmed cell death was visualized with TUNEL assay according to manufacturer’s instructions for TUNEL TMR red kit (11767291910, 5% TUNEL enzyme; Roche Diagnostic Corp).
-
GRASP55 Safeguards Proper Lysosome Function by Controlling Sorting of Lysosomal Enzymes at the GolgibioRxiv - Cell Biology 2024Quote: ... in TBS-T buffer [50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.1% Tween-20 (#A1389, AppliChem)] or with 5% BSA (#10735086001, Roche; #8076, Carl Roth) in TBS-T for phosphoprotein immunoblots ...
-
bioRxiv - Biochemistry 2024Quote: ... were harvested by centrifugation and resuspended in 25 ml lysis buffer (20 mM Tris-Hcl, pH 7.5 + 200 mM Nacl + 1 mM DTT + 5% Glycerol) and protease inhibitor (Roche, Basel, Switzerland). The suspended cells were disrupted by sonication and then cell debris was separated by centrifugation at 12,000 rpm for 45 min.
-
bioRxiv - Developmental Biology 2024Quote: ... and used in a 10 μL RT-qPCR reaction composed of 5 μL 2x KAPA SYBR FAST qPCR Master Mix (Roche, KK4600), 2.5 μL cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol and Roche Complete Protease Inhibitors) and homogenized using a high-performance disperser (Fisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... ESCs or HEK293T cells were harvested and lysed in TEN buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% Na-Deoxycholate, supplement with Roche cOmplete Protease Inhibitor). The lysates were quantified by the Bradford method and equal amount of proteins were loaded for Western blot assay ...
-
bioRxiv - Immunology 2021Quote: ... ATAC-seq libraries were amplified using 5 μl each of the i5 and i7 Nextera Indexing primers and 25 μl of 2x HiFi HotStart ReadyMix (Roche Diagnostics, KK2601). Final libraries were purified using 1x volumes of AMPureXP SPRI-beads and sequence using 75bp paired-end reads on an Illumina NextSeq500.
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... 18.75 mg/ml nitro blue tetrazolium chloride, 9.4 mg/ml 5-bromo-4-chloro-3-indolyl phosphate toluidine salt in 67% dimethyl sulfoxide, Roche; Cat. No. 1681451) was added to the third change of NDB while stirring thoroughly until completely dissolved ...
-
bioRxiv - Genomics 2022Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) supplemented with fresh protease inhibitors (AEBSF, Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Emulsions were snap-frozen in droplets in liquid nitrogen and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Genomics 2021Quote: ... on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol in MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 300 mM MgAc ...
-
bioRxiv - Neuroscience 2020Quote: ... the signal was visualized by incubation with nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolylphosphate (BCIP) solution (Roche Diagnostics, 11681451001) in 0.1 M Tris-HCl (pH9.5 ...
-
bioRxiv - Microbiology 2021Quote: The body weight of all mice was recorded weekly and blood glucose (BG) levels were measured every 5 weeks after fasting for 12 h using a glucose analyzer (Accu-Chek; Roche, Rotkreuz Switzerland) over the tail vein ...
-
bioRxiv - Microbiology 2020Quote: ... G355-5 cells were transfected with 1 to 6 µg DNA in 6 cm dishes using X-treameGENE 9 (Roche, Basel, Switzerland). The 293T/17 cell line was obtained from ATCC (CRL-11268 ...
-
bioRxiv - Cancer Biology 2021Quote: We established single-cell suspensions of surgically resected tumors by taking a small piece of PDAC tumor tissue collected in a cell-dissociation media [5 ml of minimal essential media (MEM) containing 100μl of Liberase-TM (2.5 mg/ml stock solution Roche/Sigma Aldrich Cat# 5401046001), 50μl of Kolliphor®P 188 (15 mM stock solution Sigma Cat# K4894) ...
-
bioRxiv - Cancer Biology 2022Quote: For antibody incubation 5 µl of the DigiWest Bead mixes were added to 50 µl assay buffer (Blocking Reagent for ELISA (Roche, Rotkreuz, Switzerland) supplemented with 0.2% milk powder ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellets were lysed in 200μL of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
SARS-CoV-2 Point Mutation and Deletion Spectra, and Their Association with Different Disease OutcomebioRxiv - Microbiology 2022Quote: ... Each region was amplified from 5 μl of the RNA preparation by RT-PCR using Transcriptor One Step RT-PCR kit (Roche Applied Science). To perform the RT-PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.2% NP-40, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 20 µM MG132, 5 mM DTT and Roche protease inhibitor #5892953001), and incubated for 1 h on a rotating wheel ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) in the presence of protease inhibitors (Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Suspensions were flash frozen in droplets and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in buffer F (20 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 2 mM EGTA and Roche cOmplete protease inhibitor) and lysed by fluidizer ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... A master mix was made for each qRT-PCR target containing 5 ul of KAPA Universal SYBR Fast PCR mix (KAPA Biosystems, #KK4602), 0.6ul of 5 uM forward primer ...
-
bioRxiv - Cell Biology 2022Quote: ... and then homogenized on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol with MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 3 mM MgAc ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was diluted to a final concentration of 5 ng/μl and RT–qPCR was performed with KAPA SYBR® FAST qPCR kits (KAPA Biosystems) on a C1000 thermal cycler ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-sense riboprobes against target genes were synthesized from 5 µg linearized plasmids using digoxigenin-(DIG) or fluorescein-labeled uridylyltransferase (UTP) (#11685619910, #11277073910, Roche, Mannheim, Germany) and the MAXIscript in vitro Transcription Kit (#AM1312 ...
-
bioRxiv - Pathology 2021Quote: ... 2 x 106 insect cells from 48 post infection Hi5 cells incubated at 21°C were resuspended in lysis buffer (20 mM Na phosphate pH 7.5, 500 mM NaCl, 5% glycerol, Complete protease inhibitor, Roche Diagnostics, Rotkreuz, Switzerland) and sonicated until cells were > 99% lysed as determined by microscopic examination ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Physiology 2020Quote: ... Tissues were homogenised in assay buffer provided in the kit with the addition of 5 μL of protease inhibitor cocktail (Roche, Basel Switzerland) and centrifuged at 800 × g for 10 minutes at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... 0.1% NP-40 and 5 mM β-mercaptoethanol) per gram of cells in the presence of protease inhibitors (Complete™ EDTA-free Protease Inhibitor Cocktail, Roche). Suspensions were flash frozen in droplets and cells subjected to cryogenic grinding using a Ball Mill MM 400 (5 cycles of 3 minutes at 20 Hz) ...