Labshake search
Citations for Roche :
1101 - 1150 of 1343 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x) kit (Roche) and gene-specific primers in a LightCycler 96 (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... Primary antibodies were serially applied using the U DISCOVERY 5-Plex IF procedure and the following reagents and kits (all from Ventana Medical Systems, Roche): DISCOVERY inhibitor (760-4840) ...
-
bioRxiv - Immunology 2024Quote: ... LNs obtained from organ donors were submerged in 5 mL R10 media (RPMI + 10% FBS + 1% penicillin/streptomycin + 2mM L-glutamine) supplemented with 10U/mL DNase I (Roche), cleaned of visceral fat ...
-
bioRxiv - Developmental Biology 2024Quote: ... The signals were detected by 4-nitro-blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Roche Diagnostics) in a humidified container for 12 h at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... The heat-denatured RNAs were separated on a 1% agarose gel (95% 1× MOPS buffer and 5% formaldehyde) and transferred to a positively-charged nylon membrane (Roche) by capillary flow ...
-
bioRxiv - Microbiology 2024Quote: ... pH 7.5 and various concentrations of ADP-ribose or hit compounds were mixed on ice in 384-well PCR plate (Roche). Fluorescent signals were measured from 25 to 95℃ in 0.2 C/ 30/Sec steps (excitation ...
-
bioRxiv - Immunology 2024Quote: The ear skin was minced finely with scissors and digested in RPMI1640 medium containing 333-666 µg/ml Liberase TL (1 vial with 5–10 mg pack size; Roche), 2 kU/ml DNase I (Merk Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... nuclei were re-suspended in nuclei buffer (PBS, 0,1% Tween 20 in PBS, 5% BSA, 1x Complete EDTA free protease inhibitor cocktail (Roche, 11873580001) and 20U/ml of RNase Inhibitor (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... then with 1 ml of Western blot buffer (2% SDS, 5% Glycerol, 50 mM Tris-HCl, 0.2 M EDTA + cOmplete protease inhibitor cocktail tablet (Roche, 11697498001) + PhosSTOP (Roche ...
-
bioRxiv - Plant Biology 2024Quote: ... Total 2.5 g powder of each sample was resuspended in 30-ml 1% TFA with 250 μl protease inhibitor cocktail (Roche) and then centrifuged at 12,000 ×g for 20 min at 4℃ ...
-
bioRxiv - Immunology 2024Quote: Human and murine cells were incubated in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 % NP-40, 5 % glycerol) containing 1X protease inhibitor cocktail (Roche) on ice ...
-
bioRxiv - Neuroscience 2024Quote: ... Lobes were separated into clusters of 1-5 oocytes and the follicular layer was removed i) enzymatically with Liberase (Roche) and ii ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative real-time PCR was performed in duplicate using 1:20 or 1:5 dilutions of the cDNA and SYBR Green I master mix (Roche) with a LightCycler 480 II (Roche ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Hmef1a_R_val1_193: 5′-CCGTTAAGGAGCTGCGTCG-3′), and KOD SYBR qPCR Mix (Toyobo, Osaka, Japan) in a LightCycler 96 system (Roche, Basel, Switzerland). The qPCR reaction was made with 5 µl KOD SYBR (TOYOBO) ...
-
bioRxiv - Genomics 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Neuroscience 2024Quote: ... the slides were incubated for ∼72 hours at 37°C in staining solution containing nitro blue tetrazolium and 5- bromo-4-chloro-3-indolyl-phosphate (Roche). The slides were finally washed ...
-
bioRxiv - Cancer Biology 2024Quote: ... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... gene expression (5’Gex) and TCR libraries were generated then quantified via Agilent Technologies 4200 Tapestation and KAPA library quantification kit (Roche). Targeted read depth included 25,000 reads per cell for gene expression libraries and 5,000 reads per cell for TCR libraries ...
-
bioRxiv - Developmental Biology 2024Quote: ... knee cartilage was harvested from postnatal day 3-5 mice and treated with 3 mg/ml collagenase D (11088866001, Roche) in DMEM (10569010 ...
-
bioRxiv - Bioengineering 2024Quote: ... in PBS (PBST) and then blocked for 3 hours at RT in PBS with 5 wt% bovine serum albumin (BSA, Roche), 5% goat serum (Gibco) ...
-
Ion channel function of polycystin-2/polycystin-1 heteromer revealed by structure-guided mutagenesisbioRxiv - Biophysics 2024Quote: ... Oocytes were subsequently transferred into 1 mL lysis buffer (Tris 25mM, NaCl 150 mM, EDTA 1mM, NP40 1%, Glycerol 5%, supplemented with Roche cOmplete™ protease inhibitor cocktail ...
-
bioRxiv - Biochemistry 2024Quote: Cells were resuspended in cold lysis buffer (50 mM Hepes pH 8, 50 mM NaCl, 5 mM MgCl2 and 1 tablet 50 mL−1 EDTA-free protease inhibitor, Roche) plus 0.5 mg/mL lysozyme and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... Blots were then washed three times for 5 min with TBST and developed using the Lumi-Light Western Blotting Substrate (Hoffmann-La Roche). The chemiluminescence signal was detected using a Fusion FX6 reader (Vilber ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA) and 5% (v/v) glycerol and supplemented with a protease inhibitor cocktail tablet and a phosphatase inhibitor tablet (Roche). Lysates were briefly sonicated on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... The buffer was aspirated and minced tissue was digested in 5 ml cold HBSS adding 100 μl 10mg/ml Collagenase P (Roche) for 15-20 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Incubation of primary antibodies was performed overnight at 4 °C in 5% non-fat dry milk or 3.5% BSA (Roche, 10735086001). After three washes in PBS-T ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... Coralville, Iowa, USA) and 0.25 µl reverse primer (5 µM, IDT) and was analyzed on a LC480 instrument (Roche, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2021Quote: C2C12 cell lysate was generated using 5 million cells in RIPA lysis buffer with protease/phosphatase inhibitors (Roche #11836145001 and #04906837001), and 20μg of protein was loaded on a denaturing SDS page gel for detection of the VGLL2-NCOA2 fusion ...
-
bioRxiv - Immunology 2020Quote: ... The proliferation rate of lymphocytes was measured using 5-Bromo-2-deoxyuridine (BrDU) assay as per the manufacturer instructions (Cell Proliferation ELISA BrDU, Roche, USA).
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR reactions were conducted in a 10-µL final volume with 5 µL of 2X FastStar Universal SyBR green Master (Roche, Switzerland), 1.5 µL of forward/reverse primer mix (Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... After that pelleted beads were gently resuspended in washing buffer containing 4xTBS, 5% NP-40, phosphatase inhibitors (10mM NaF, 1mM Na3VO4) and protease inhibitors (cOmplete®, Roche) and washed 10 times with gentle agitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11644793001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... before lysis in swelling buffer (5 mM PIPES pH8.0, 85mM KCl) freshly supplemented with 1x protease inhibitor cocktail (Roche, cat. 04693116001) and 0.5% NP-40 ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480; Roche Diagnostics, Mannheim, Germany) with SYBR Green I dye and gene-specific primers (Supplemental Table S8) ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed twice in PBS and resuspended in 100 μL annexin V incubation buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 5 mM CaCl2) containing 1% annexin V FLOUS (Roche Molecular Biochemicals) and 500 μg/μl PI stain ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Developmental Biology 2021Quote: ... The tissue was then washed with PBST extensively (10 times or more for 5 minutes) before development with BM-purple (1ml peer well, Roche Diagnostics). Time of development was approximately 24 hours at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 148.5 mM NaCl, 0.5 mM EDTA, 0.5% NP-40, 1x PhosSTOP Roche, 5x cOmplete protease inhibitor cocktail Roche, 1 mM DTT) using a cell scraper (TPP 99003) ...
-
bioRxiv - Microbiology 2022Quote: ... The capsids were suspended in sample buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, PIs [Roche cOmplete]), and adsorbed to nitrocellulose membranes (BioTrace™ ...
-
bioRxiv - Microbiology 2022Quote: The samples were lysed in Laemmli buffer (1% [w/v] SDS, 50 mM Tris-HCl, pH 6.8, 1% [v/v] β-mercaptoethanol, 5% [v/v] glycerol, bromophenol blue, PIs [Roche cOmplete]). The proteins were separated on linear 7.5 to 12% or 10 to 15% SDS-PAGE ...
-
bioRxiv - Microbiology 2022Quote: ... 50 µl of the post-nuclear supernatant was saved as the input lysate and 450 µl was incubated with 5 µg of anti-GFP antibody (Roche 11814460001) for 1 hour at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 mL of digestion Buffer containing collagenase D (2mg/mL, Roche #11088858001) and DNase (0.125 mg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were re-suspended in 1 mL lysis buffer (5 mM EDTA, 1% NP-40 in PBS) supplemented with 2X cOmplete™ inhibitor (Roche) and were sonicated until the lysate became turbid ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were pelleted by centrifugation at 2500g for 5 minutes and resuspended in 880ul Nuclear Lysis Buffer (50mM Tris HCl, 10mM EDTA, 1% SDS, 1X protease inhibitors (Roche, 04693124001)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche, Switzerland). All primer sequences used in this study are listed in Supplementary materials (Supplementary Table S1).
-
bioRxiv - Neuroscience 2020Quote: ... nt 1280-1350 from sequence NM_008553 detected with the mASCL1 probe (Universal Probe Library probe #74, Roche, Cat.No. 04688970001; 5′-(Fam)-GGCAGCAG-(Dark Quencher)-3′) ...