Labshake search
Citations for Roche :
1201 - 1250 of 3510 citations for 4 Chloro 2 iodothieno 2 3 b pyridine 5 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were collected and washed with ice-cold 1X PBS before being resuspended in Sonication Buffer (20 mM Tris, pH 8.0, 2 mM EDTA, 0.5 mM EGTA, 1X Complete Mini EDTA-free Protease Inhibitor Cocktail [Roche 11836170001] ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μl of 1:25 diluted cDNA with water was used for real-time PCR (LightCycler 480 Roche) using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... The nucleus was stained with 4,6-Diamidino-2-phenylindole (DAPI, 1 µg/mL in PBS) (Roche; Basel, Switzerland). Finally ...
-
bioRxiv - Cell Biology 2023Quote: ... and lysed in lysis buffer (50mM Tris, pH 7.4, 500mM NaCl, 0.4% SDS, 2% Triton-X-100, 1mM DTT, 1x complete protease inhibitor [Roche]). Lysates were sonicated twice for 1 minute at 30% duty cycle at an output level of 4 ...
-
bioRxiv - Biophysics 2022Quote: ... Isolated membrane fractions were diluted 1:2 in buffer EXT supplemented with protease inhibitors (Roche cOmplete EDTA-free) and 1% (w/v ...
-
bioRxiv - Genomics 2023Quote: ... treated at 55°C and then pre-cleared with 1:2 KAPA Pure beads (Roche Cat. No: 07983298001). The quality and quantity of fragmented DNA were verified using agarose gel (1.5% ...
-
bioRxiv - Genomics 2023Quote: ... Library QC was performed before and after capture in 2 steps: quantification using qPCR (Kapa Biosystems, part #KK4602) and QC using LabChip GX Touch HT Nucleic Acid Analyzer ...
-
bioRxiv - Neuroscience 2024Quote: ... whereas the pellet (insoluble fraction) was resuspended in 2% SDS/TBS supplemented with protease inhibitor cocktail (Roche, Switzerland), 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 300 mM NaCl, 3.0 mM MgCl2, 2 mM DTT, 0.2 % Triton X-100, 1 tablet cOmplete Mini, Roche) and 150 μL MQ ...
-
bioRxiv - Immunology 2024Quote: ... Digestion was performed for 30 min at 37⍰C with 2 mg/ml collagenase D (Roche, Meylan, France), 1 mg/ml dispase (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... then Lysis Buffer 2 (10 mM Tris-HCl pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1x Roche cOmplete™ ...
-
bioRxiv - Cell Biology 2024Quote: Cultured cells were lysed on ice through repeated pipetting in 2% SDS supplemented with Protease Inhibitor Cocktail (Roche) and PhosStop phosphatase inhibitor (Roche) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mice (n=2 per group) were randomly assigned to receive either diazepam (synthesized by F. Hoffmann-La Roche) 0.3 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Blocking was performed in MAB blocking buffer (100 mM Maleic acid, 150 mM NaCl, 2% Blocking reagent [Roche, 1096176] ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA (2 µl) was added to the mixture with FastStart SYBR Green Master Mix kit (Roche, Basel, Switzerland) and specific primers SP_F 5’-GAC-CAG-TCG-AAC-GCA-CAT-TG-3’ and SP_R 5’-CGG-AGA-GGG-TTG-TTG-TGT-CT-3’ ...
-
bioRxiv - Physiology 2024Quote: ... Glomus cells were dissociated using a mixture of collagenase P (2 mg/ml; Roche Applied Science, Indianapolis, IN), DNase (15 μg/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl RNA were incubated for 10 min at room temperature with 0.6 µg baker’s yeast tRNAPhe (Roche), 1 mM MgCl2 and increasing amounts of protein in a volume of 20 µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tumor tissue was mechanically dissociated into 2-4mm pieces and then digested in 2.5 mg/mL Liberase and 0.1 mg/mL DNase (Roche) for 1 hour at 37C ...
-
bioRxiv - Developmental Biology 2024Quote: ... were added to freshly prepared DB1 buffer (10 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5 mM spermidine, 2% glycerol, 1× EDTA-free with Roche complete protease inhibitor ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 25μl of 1X PCR buffer B (Kapa Biosystems, Boston, MA, USA) pre-warmed at 65°C was added then the legs were ground ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by mechanical dissociation and treatment with 0.1% collagenase B (Roche) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the transfected cells underwent initial selection with Hygromycin B (Roche, 10843555001) and were subsequently sorted into single colonies in 96-well plates via flow cytometry.
-
bioRxiv - Developmental Biology 2023Quote: ... hiPSCs were selected with hygromycin B (50μg/ml; 843555001, Roche Diagnostics), puromycin (1μg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were then dissociated using 0.6 mg/mL collagenase B (Roche) for 1 hour in a 37 °C incubator ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Immunology 2023Quote: ... 3 mM ATP (Roche), 25 μg/ml MSU (InvivoGen) ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 mM Tris/HCl pH 7.4/50 mM NaF, 10 mM Na4P2O7, 2 mM MgCl2 and Complete Mini, EDTA-free protease inhibitor [Roche]). Lysates were cleared and incubated with GFP-Trap agarose beads for 60 min ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were lysed in Immunoprecipitation buffer (150 mM NaCl, 10 mM Hepes, 2 mM EDTA, 1% Triton, 1.5 mM MgCl2, 10% glycerol, protease inhibitor from Roche) and centrifuged at 14,000 × g ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS and 50 mM DTT with the addition of anti-protease (cOmplete cocktail, Roche 11 873 588 001). Samples were boiled 5 min at 95°C before loading on polyacrylamide gels ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 mM EDTA, 15% glycerol, 2 mM MgCl2, 1 mM DTT, 1 mM PMSF, and protease inhibitor cocktail [Roche]). Following clarification by centrifugation ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-μl aliquots of all cDNA samples were analyzed in triplicate on 96-well optical PCR plates (Roche Diagnostics). GAPDH or TBP was used as the reference gene and all analyses were performed using the ΔΔCt method with Roche LightCycler 96 system software ...
-
bioRxiv - Developmental Biology 2021Quote: ... apob-1 and apob-2 levels were detected using the Fast Start Essential Green DNA master mix (Roche 06924204001) on a Roche LightCycler 96 instrument ...
-
bioRxiv - Developmental Biology 2021Quote: ... blocked in 1xBM Blocking/PBST at RT for 2 hours and incubated with anti-DIG-POD (1:1,000, 11207733910, Roche) at 4°C overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... DRGs from E13.5 embryos were dissected and placed in droplets of 2 mg/ml collagen (Roche Diagnostic, catalog#11179179001) together with COS1 aggregates transfected with either secreted Myc-Sema3A or control PAY1-GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA probes were incubated for 2 hours at 37 degrees with Dig RNA labeling mix (11277073910, Roche, Basel, Switzerland) and SP6 or T7 RNA polymerase (RPOLSP6-RO and RPOLT7-RO ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of PCR gene specific primer (10X conc) (Table S1) and 10 μl of master mix (Roche 04707516001) in 20 μl reaction ...
-
bioRxiv - Genomics 2020Quote: ... the pellets were washed with ice-cold nuclei suspension buffer (1X PBS containing 2% BSA and 0.2 U/µl Protector RNase Inhibitor, ROCHE) and filtered through a 30μm cell strainer (Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Cell suspension was then supplemented with 1 mM Tris (2-carboxyethyl) phosphine (TCEP) and 1× complete inhibitor cocktail (Roche). Cells were lysed by sonication on ice and then centrifuged at 80,000 g at 4 °C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
bioRxiv - Immunology 2021Quote: ... Lungs were dissected and digested for 30min at 37°C using RPMI media (2% FBS+ Pen/Strep, glutamine, 10mM HEPES) containing 0.5mg/mL Collagenase D (Roche). The digested fragments were passed through a 70μm cell strainer (Greiner bio-one ...
-
bioRxiv - Molecular Biology 2020Quote: ... and subjected to 8 cycles of lysis in a MagNALyser (Roche – 6000 rpm, 1 min on, 2 min off). Lysate was transferred to fresh microfuge tubes and clarified by centrifugation (13,000 rpm ...
-
bioRxiv - Cancer Biology 2021Quote: Human tumor samples were collected on different days right after surgery and digested in Hank’s Balanced Salt Solution supplemented with 2 mg/mL collagenase A (Roche), 2.5 U/mL hyaluronidase (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 mM ATP and 10% glycerol) containing 1 mmol/L PMSF and DNase I (Roche Diagnostics Corp., IN, USA) to 5 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in ice-cold homogenizing buffer (20 mM HEPES pH 7.4, 250 mM sucrose, 2 mM MgCl2, and EDTA-free protease inhibitor cocktail [Roche]), and homogenized on ice by 25 passages through a 26-guage needle fitted to a 1 mL syringe ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4 °C for 4 hr and washed two times with its resuspending buffer and once with E100 buffer (25 mM HEPES-KOH pH7.5, 10 % glycerol, 100 mM KCl, 2 mM MgCl2, 1 mM EDTA with Roche cOmplete™ ...
-
bioRxiv - Immunology 2020Quote: ... The red blood cell layer was lysed with 2 mL of Red Blood Cell Lysis Buffer (Cat# 11814389001, Roche) in a 15 mL tube ...
-
bioRxiv - Biophysics 2020Quote: ... N2A cells were transfected with 1.0 μg of a cDNA construct and 2 μL of X-tremeGENE HP DNA transfection reagent (Roche Diagnostics GmbH ...