Labshake search
Citations for Roche :
1051 - 1100 of 3510 citations for 4 Chloro 2 iodothieno 2 3 b pyridine 5 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were cultivated in the presence of IL-2 (10 IU/mL, Roche, Basel, Switzerland). Three days after coinfection cells were sorted based on expression of mouse CD48 and mCD24 (BD biosciences ...
-
Extrusion fountains are hallmarks of chromosome organization emerging upon zygotic genome activationbioRxiv - Molecular Biology 2023Quote: 400-600 embryos were homogenized in 2 ml 0.5 % Danieau’s with protease inhibitor cocktail (PIC, Roche) and 1 % (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... 2% Triton X-100) containing ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche cOmplete, Sigma Aldrich)] ...
-
bioRxiv - Pathology 2023Quote: ... The digestion was stopped with 2 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitors (Complete-TM, Roche) followed by centrifugation at 18,000 x g for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... D-Mel (d.mel-2) cells were transfected using X-tremeGene HP DNA transfection reagent (#06366236001, Roche). Two days after transfection ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1% sodium dodecyl sulfate) supplemented with 2% v/v protease inhibitor cocktail (Roche; Catalog #11697498001) and 1% v/v phosphatase inhibitor cocktail (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... The clarified lysate was incubated with 2 mL of pre-equilibrated Protein C affinity resin (Roche) for 3 h at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM DTT) supplemented with 0.3 mg.mL-1 lysozyme and EDTA-free protease inhibitor cocktail (Roche) prior to pressure-assisted lysis using a French press system ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 mM DTT) supplemented with one tablet cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) and 1 mg/ml lysozyme ...
-
bioRxiv - Cell Biology 2022Quote: ... the retinas were sonicated in 200 μL of 2% SDS containing protease inhibitor mixture (eComplete; Roche) in PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... fixed in 2% PFA diluted in HM supplemented with PhosSTOP (04906837001 Roche, one tablet/10 ml) for 15 hours at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNasin 400 U/ml and RVC 2 mM) supplemented with protease inhibitor (complete EDTA free, Roche). 60 μL of equilibrated Dynabeads Protein G (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were then washed in 0.2x SSC and MBST before blocking with 2% blocking solution (Roche) for at least 1 hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... CD4+ T cells were cultured in RPMI + IL-2 (final concentration 100 U/mL, Roche, 10799068001), IL-7 (final conc ...
-
bioRxiv - Biochemistry 2023Quote: ... The clarified lysate was incubated with 2 ml of pre-equilibrated Protein C affinity resin (Roche) for 2h at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 μg) using X-tremeGENE HP (1:2 DNA:reagent ratio) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Biophysics 2024Quote: ... 0.5-2 M of urea (depending on the construct) and one protease inhibitor cocktail tablet (Roche). Following sonication on ice (10 min at 40 % power ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μg of plasmid was transfected using 2 μL X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: Colony PCR reactions were then performed as follows: 2 µL of KAPA HiFi HotStart ReadyMix (Roche) was assembled with 0.8 µL of 1:10 bacteria dilution ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 2 hours at room temperature and then incubated in anti-DIG-AP (Roche, 1:2000) overnight at 4°C and washed and developed with Fast Blue as described in (King 2013) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Immunology 2021Quote: ... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... Incubation of primary antibodies was performed overnight at 4 °C in 5% non-fat dry milk or 3.5% BSA (Roche, 10735086001). After three washes in PBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... CMII agar with 250 μg/ml hygromycin B (Roche, Germany), 200 μg/ml G418 (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated with collagenase B (1.8 mg/ml, Roche) and D (2.4 mg/ml ...
-
bioRxiv - Genetics 2023Quote: Bottom Agar + Hygromycin B (Roche Cat#10843555001, 150 μg/mL).
-
bioRxiv - Cell Biology 2023Quote: ... Liver tissue was digested with pronase and collagenase B (Roche) and the cell suspension was subsequently separated by an 11.5% Optiprep gradient (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... Liver tissue was digested with pronase and collagenase B (Roche) and the cell suspension was subsequently separated by an 11.5% Optiprep gradient (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.05M Tris HCl pH 7.9, 5μM MgCl2, 5μM CaCl2, 2% SDS supplemented with 1x protease inhibitor cocktail, ROCHE) by sonication on ice ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 M NaCl 1 mM TCEP) supplemented by one protease inhibitor cocktail tablet Complete EDTA-free (Roche) and centrifuged for 30 min at 18,000 g 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercaptoethanol and supplemented with complete EDTA-free cocktail tablets (1 tablet/50ml cells; Roche), 0.01 mg/ml DNase (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM imidazole and 2 mM β-mercaptoethanol) supplemented with DNaseI (AppliChem) and Complete Protease inhibitor (Roche). After one passage through a French press cell ...
-
bioRxiv - Microbiology 2020Quote: ... Cobas SARS-CoV-2 PCR Test for the Cobas 6800 System (Roche Molecular Systems, Branchburg, NJ, USA) was used to detect the presence of SARS-CoV-2 [11].
-
bioRxiv - Microbiology 2022Quote: All samples were tested with: (1) the Roche Nucleocapsid Elecsys Anti-SARS-Cov-2 (Roche, IND, USA) assay (to confirm eligibility) ...
-
bioRxiv - Genetics 2022Quote: ... The PCR procedure was performed by adding 25μL 2 × KAPA HiFi HotStart Ready Mix (KAPA biosystems, KM2602) with 2.5ul primers of NEB Oligos kit and 2.5ul Illumina universal primers ...
-
bioRxiv - Genetics 2021Quote: ... which was suspended into 1 ml cold Buffer B70 supplemented with 2 × cOmplete Proteinase inhibitor cocktail (Roche) and 5 μl Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Genetics 2021Quote: ... Worms were then resuspended in 0.4 ml Buffer B70 supplemented with 2 × cOmplete Proteinase inhibitor cocktail (Roche) and dripped into liquid N2 with 1 ml pipette tips to form small pearls ...
-
bioRxiv - Immunology 2020Quote: ... Fresh tissue was initially cut into small pieces and digested with collagenase VI (2 mg/ml; Roche) for 30 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: Pellets of 1x107 cells were lysed with 1mL Co-IP Lysis Buffer (300mM NaCl, 50mM Tris HCL pH7.4, 0.5% NP40, 0.1% Sodium deoxycholate, 2% SDS) with PhosSTOP (Roche) and cOmplete (Roche ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Immunology 2020Quote: An aliquot was thawed and tested at NorthShore using the Elecsys Anti-SARS-CoV-2 (Roche Diagnostics), Access SARS-CoV-2 IgG (Beckman Coulter) ...