Labshake search
Citations for Roche :
1001 - 1050 of 6565 citations for Estrone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: HeLa cells were plated in 6-well plates and infected with virus at equal amounts of p24 after treatment with DNaseI (Roche) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells in culture were seeded into 96 well plates and transfected in suspension using X-tremeGENE HP DNA Transfection Reagent (Roche). Transfection complexes were prepared such that each reaction contained 11 μL of Opti-MEM ...
-
bioRxiv - Microbiology 2020Quote: ... Amplifications were performed using a 96-well plate in a pre-heated LightCycler® 480 Instrument II (Roche, Basel, Switzerland). Each well contained a 10 μl reaction mixture comprising 1 μl DNA template ...
-
bioRxiv - Cancer Biology 2021Quote: 160 μl DMEM containing 10 % FBS were added to the bottom wells of xCELLigence Real-Time Cell Analyzer CIM plate (Roche), as chemo-attractant ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were spun (420 RCF x 2 min on LCM-3000 plate centrifuge (Grant Instruments, Royston, UK) before analysis on the Light Cycler 480 (Roche). Samples were run for 50 cycles (10s at 95°C and 30s at 60°C) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1·104 cells per well were seeded onto E-Plates 16 and analysed in the xCELLigence RTCA DP system (Roche) for 48 h in quadruplicates.
-
bioRxiv - Biophysics 2022Quote: ... For a given RT-qPCR reaction 10 nM of RNA were incubated in water with DMSO or 10 μM of small molecules at room temperature for 20 mins in a 96 well lightcycler plate (Roche). During incubation an RT-qPCR mastermix was prepared by adding 25 μL of 1 step SYBR mastermix (QuantaBio) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... resuspended at 1 million cells per mL in CETSA buffer and dispensed (10 μL per well) into 384-well PCR plates (Roche) using a Multidrop Combi (ThermoFisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... COS-7 cells were plated in 6-well plates (100,000 cells/well) and transfected the next day using X-tremeGENE™ 9 DNA (Transfection Reagent, Roche), with HA-NLGN1 + AP-MDGA1 or AP-MDGA2 + BirAER (1 μg/well) ...
-
bioRxiv - Biochemistry 2020Quote: ... was added to a final concentration of 5X and mixtures were aliquoted to a final volume of 15 µL into a LightCycle 96-well white qPCR plate (Roche). Thermal denaturation was conducted in a LightCycler 480 (Roche ...
-
bioRxiv - Neuroscience 2019Quote: DIV14-15 cortical neurons (250.000 neurons/mL in laminin/poly-L-ornithine coated 6-well plates) were washed and scraped with ice cold PBS with protease inhibitor cocktail (Roche). Neurons were pelleted (5 minutes at 3000 g at 4°C) ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Immunology 2019Quote: ... LN were pierced and torn with sharp forceps in 24-well plates and incubated for 15 min at 37° C in 1 ml digestion buffer (100 U/ml collagenase A (Roche), 500 U/ml collagenase D (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... qRT-PCRs were performed in 96-well plates in a PCR thermal cycler (Applied Biosciences 7900HT) using a 2x FastStart TagMan Probe Mastermix assay (Roche) with a probe concentration of 100 nm and a primer concentration of 200 nm with the following primers ...
-
bioRxiv - Immunology 2019Quote: ... memory B cells were plated at 6 B cells in 55 μl per well into 96 × 384-well plates in B cell media supplemented with 100 U ml−1 IL-2 (Roche), 50 ng ml−1 IL-21 (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Developmental Biology 2021Quote: H9 human pluripotent stem cells were maintained in E8 media and passaged every four days onto matrigel-coated plates (Roche). ESCs ...
-
bioRxiv - Biochemistry 2021Quote: Cells confluent in a 15-cm dish were washed by PBS buffer three times before being lysed on plate with 1 mL ice-cold NP-40 lysis buffer supplemented with protease inhibitor cocktail (Roche) and PhosSTOP (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... mRNA expression was quantified in technical triplicates using RT-qPCR performed in 384-well plates on a Roche LightCycler 480 Instrument II with dual hybridisation probes from The Universal ProbeLibrary (Roche). Oligonucleotide sequences used for RT-qPCR are listed in Appendix Table S3 ...
-
bioRxiv - Bioengineering 2020Quote: ... Hela cells were plated one day before in 6-well plate at 50% confluency and transfected with 1 μg plasmid and 3 μl XtremeGeneHP transfection reagent (Roche) during 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and low-volume supernatants (90 μL media per well of a 48-well plate) were mixed 1:1 with 2× SDS/PAGE sample buffer containing Complete Mini EDTA-free Protease Inhibitor Mixture (Roche). In experiments where primary hMDMs were plated in a 24-well plate and infected with T4SS-Lp ...
-
bioRxiv - Genomics 2021Quote: ... Early passage cells were seeded at 25% confluency in six-well plates and transfected with 2 ug of expression vector using Fugene reagent (Roche). Cells were harvested and seeded into 100 mm dishes after 48 h of transfection ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR was performed using SYBR green technology in 96 well optical plates with lightcycler 480 real-time PCR machine (Roche) adopting the following thermocycle conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time reverse transcription PCR assays were conducted in 96-well plates using the LightCycler 480 Instrument (Roche, Wilmington, MA). Levels of mRNA expression were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Microbiology 2022Quote: ... Leishmania promastigotes were placed on 96-well flat-bottom plates in the presence of tetrazole salt (XTT) (ROCHE Applied Science) and incubated at 26°C for 4 hours in the dark ...
-
bioRxiv - Cell Biology 2022Quote: ... was used to analyze 4.5 µl of the cDNA dilution in 10 µl reactions on a white LightCycler® 480 Multiwell Plate 384 (Roche). To confirm the absence of PCR contamination ...
-
bioRxiv - Cell Biology 2023Quote: Cells from a well of 12-well plate were lysed on ice in 80 µL RIPA buffer (Thermo) supplemented with protease inhibitor cocktail (Roche) and Benzonase (Novagen ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells were seeded at 400,000 cells per well in 6-well plates and transfected the day after with indicated cDNA constructs with FuGENE6 (Roche). Reverse transfection of siRNAs was carried out using RNAiMAX according to the manufacturer’s instructions (Invitrogen Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells were seeded 72 hours prior to the experiment at 400,000 cells per well in 6-well plates and transfected the next day with wt or mutated myc-ALPK1 constructs with FuGENE6 (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were then transferred to a glass depression slide using a glass pasteur pipette and were collected under a dissection microscope and transferred to a well of a 96-well plate filled with 150 μL of BM Purple development solution (Roche). The 96-well plate was kept in the dark for embryo staining to develop ...
-
bioRxiv - Neuroscience 2022Quote: Proteins were harvested from ∼30 mg of tissue (in vivo) or two 6-well plates (in vitro) and homogenised in Ripa buffer with complete mini-proteinase inhibitors (Roche). Preparation of nuclear and cytoplasmic extracts from human fibroblasts was performed using a NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher) ...
-
bioRxiv - Physiology 2023Quote: ... Each RT-qPCR assay was deposited in triplicates on a FrameStar® 384-well skirted qPCR plate (Roche Diagnostics, Switzerland). The qPCR program was initiated at 95°C for 10 minutes to denature the cDNA and activate the TAQ polymerase enzyme in a thermocycler (Lightcycler® 480 II Roche thermocycler ...
-
bioRxiv - Pathology 2023Quote: ... in HEK 293T cells (3×105 cells per well in 6-well plates) using X-treme gene transfection reagent (Roche). Pseudotyping was achieved by co-transfecting pHEF-VSVg (400 ng/well) ...
-
bioRxiv - Neuroscience 2024Quote: ... proteins were extracted by resuspending cells from 6-well plates in 100 μl of RIPA or 7M Urea Buffer containing protease inhibitor (11873580001, Roche) and ...
-
bioRxiv - Biochemistry 2023Quote: ... were used to inoculate each well of a 96-well plate containing 196 μL of LB media (supplemented with ampicillin, and 200uM IPTG) The plate was covered with transparent LightCycler480 Sealing Foil (Roche), and grown for 24 h in a Biotek Synergy H1 plate reader at 42 °C with double orbital shaking ...
-
bioRxiv - Cancer Biology 2023Quote: ... quantitative real-time PCR was performed in duplicates in 384-well plates using Fast Start SYBR Green Master Rox (Roche) on a QuantStudio™ 5 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Bioengineering 2024Quote: All qPCR reactions were carried out using 384-well plates in 3 technical replicates in 10 µl final reaction volume on the LightCycler 480 System II (Roche). Reaction mix consisted of Power Track SYBR Green Master Mix 2X ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 100 ng of pCAG-mCherry were transfected into 80% confluent HEK293T cells in 24-well plates using FuGene6 (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... The batches of isolated RNA were arranged sequentially in 96-well plates for quality control and preparation of libraries using the standard automated KAPA stranded mRNA library preparation protocol (Roche). One sample was lost in transport before library preparation (HG03478 (MSL)) ...
-
bioRxiv - Genetics 2024Quote: ... The 5μl total volume reaction was loaded in 384-well plates and was performed in a LightCycler 480 Instrument II (Roche), using a cycling program of ...
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM ß-mercaptoethanol (BME)) supplemented with 1 mM phenylmethylsulfonyl fluoride and 10 μg/mL DNase (Roche). The resuspension was processed with an Emulsiflex-C5 homogenizer (Avestin) ...
-
bioRxiv - Microbiology 2019Quote: ... and CO2 reverse primer (5′-TACCTTGTTACGACT-3′)53 with KAPA Lightcycler 480 mix (KAPA Biosystems Ltd., UK) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Cancer Biology 2019Quote: ... The embryos were subsequently incubated in the blocking solution (2%Roche block, 5% calf serum, 1% DMSO). γH2AX antibody (GTX127342 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and 5 mM ethylenediaminetetraacetic acid (pH 8.0)] containing protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA) for 45 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... the presynaptic filament was formed by incubating 5 μl of streptavidin-coated magnetic resin (Roche Molecular Biochemicals) with 5’-biotinylated 80-mer ssDNA oligonucleotide (5 μM ...