Labshake search
Citations for Roche :
1001 - 1050 of 6830 citations for 4 Chloro 6 fluorobenzene 1 3 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Single-cell suspensions of the tumors were obtained by incubating minced tissues with 3 mg/mL collagenase A (Roche, Germany) and 1 mg/mL DNase I (Roche ...
-
bioRxiv - Immunology 2024Quote: Single-cell suspensions of the tumors were obtained by incubating minced tissues with 3 mg/mL collagenase A (Roche, Germany) and 1 mg/mL DNase I (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Developmental Biology 2024Quote: ... dissected hindbrains were fixed in 4% PFA for 1 hour (and stored up to 3 months) and stained as previously described (Myat et al., 1996) using a digoxygenin-labelled riboprobe (Roche) against the target mRNA sequence (Table 3) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was then subjected to further purification by precipitation with 3 volumes of KAPA Pure Beads according to manufacturer’s instructions (KAPA Biosystems). The assessment of RNA integrity number (RIN ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Hmef1a_R_val1_193: 5′-CCGTTAAGGAGCTGCGTCG-3′), and KOD SYBR qPCR Mix (Toyobo, Osaka, Japan) in a LightCycler 96 system (Roche, Basel, Switzerland). The qPCR reaction was made with 5 µl KOD SYBR (TOYOBO) ...
-
bioRxiv - Neuroscience 2024Quote: ... Lung tissues were cut into small pieces and then digested in RPMI1640 containing 3 mg/mL of collagenase A (Roche) and 0.15 mg/mL of DNase I (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... Next the beads were washed 3 times with 800 µl of wash buffer (TBS + 0.1% Tween, EDTA-free Protease Inhibitor Cocktail (Roche, 04693132001)) ...
-
bioRxiv - Bioengineering 2024Quote: ... in PBS (PBST) and then blocked for 3 hours at RT in PBS with 5 wt% bovine serum albumin (BSA, Roche), 5% goat serum (Gibco) ...
-
bioRxiv - Genomics 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Biophysics 2024Quote: ... 150 mM NaCl and 2 mM CaCl2 (“Na + Ca”) were incubated at 37° C with Proteinase K (3 μg/ml) (Roche). Aliquots are removed at different time intervals following addition of the protease (0 ...
-
bioRxiv - Bioengineering 2024Quote: ... lung tissue was minced and incubated in 3 mL of serum-free media containing 0.5 mg/mL DNase I (Roche, 10104159001) and 1 mg/mL collagenase type IV (Worthington ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA probes were generated via PCR amplification from 3 dpf cDNA fused to T7 promoter sequence and subsequently transcribed (DIG or FITC labeled) using T7 polymerase (Roche). Primer sequences can be found in supplemental table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... at 4°C for 1 hour with end-over-end rotation and washed 3 times with 1X MAPK Lysis Buffer with 1X protease inhibitor (Complete, Roche). Worm lysates prepared from the above were then equally divided into tubes containing glutathione beads coated with respective proteins for 2 hours incubation at 4°C with end-over-end rotation ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in a protoplast buffer (100 mM Tris-HCl pH 7.5, 2 mM MgCl2, 1M Sucrose, 6 μg/mL of DNAse/ RNAse, 1x protein inhibitor Roche, 800 U mutanolysin, 8 mg/ml lysozyme) and incubated at 30°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.3 M NaCl, 1 mM MgCl2, 10% glycerol, 1 mM EDTA, 1 mM beta-mercaptoethanol, 0.01% IGEPAL CA-630, 1× Roche cOmplete protease inhibitors ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were then probed overnight at 4℃ in anti-GFP (mouse monoclonal IgG1κ, cat#: 11814460001 Millipore Sigma/Roche) diluted 1:1000 in 5% Applichem nonfat dried milk in TBS-T ...
-
bioRxiv - Cell Biology 2022Quote: ... before being detached with 40 μL of ice-cold native lysis buffer (80 mM PIPES pH 6.9, 2 mM MgCl2, 4 mM EGTA, 0.2% saponin, 5x cOmplete protease inhibitor cocktail Roche). The lysate was collected in 1.5 mL tube and incubated on ice for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Cell Biology 2021Quote: ... was homogenized and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and chromatin was extracted overnight at 4°C in 0.5X PBS (67.5 mM NaCl) with a protease inhibitor cocktail (Roche) on an end-over-end rotator ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections on slides were post-fixed at 4% PFA in 0.1M PB and treated with proteinase K (Roche). Sections were hybridized with digoxigenin (DIG)-labeled probes at 72°C overnight in hybridization solution ...
-
bioRxiv - Physiology 2023Quote: ... Tissues were chopped with scissors and digested in a cocktail containing 4 units/mL LiberaseTM (Roche; Catalog# 355374) and 0.744 units/mL Elastase (Worthington Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µl cDNA and 5 µl of LightCycler 480 SYBR Green I Master mix (Roche Diagnostics GmbH, Germany). Three technical replicates of each sample were included ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 8.5 was added and this reaction was treated with 4 Units of Alkaline Phosphatase (Roche Life Science) at 37°C for 1 hour ...
-
bioRxiv - Plant Biology 2022Quote: ... 200 mM NaCl, 1 mM EDTA, 1%NP-40, 1 mM DTT, 10 mM MgCl2, 1 × protease inhibitor cocktail from Roche) for 2 h at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM NaF, 1 mM Na3VO4, 1 mM PMSF, protease inhibitor cocktail [1 tablet in 50 mL lysis buffer, Roche]). The whole cell extract was denatured ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM EGTA and 1 mM dithiothreitol) with 1% protease inhibitor cocktail (04693116001, Roche) and diluted 1x with the 2x loading buffer (65.8 mM Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: ... cells were washed twice with Buffer 1 (1× eBioscience Perm/Wash Buffer, 1× Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 uL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-PARP1 1:1000 (1 835 238 Roche), anti-tubulin 1:5000 (B-5-1-2 Santa Cruz) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP (mouse, Roche AB_390913, Substrate 1:1); anti-actin (mouse ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... HA-HRP (Roche, 12013819001, 1:1,000-1:5,000), MPP6 (Atlas antibodies ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...