Labshake search
Citations for Roche :
951 - 1000 of 2356 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The membranes were blocked in 5% BSA (Roche, 10 735 086 001) in TBS-T before overnight incubation at 4°C with primary antibodies ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM β-ME) supplied with Complete EDTA-free Protease Inhibitors (Roche) per manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... 1% Triton X-100 and 5% glycerol) supplemented with protease inhibitor (Roche), 1 μL/mL Ready-LyseTM Lysozyme Solution (Lucigen ...
-
bioRxiv - Microbiology 2024Quote: ... [5] and the Lightcycler Multiplex RNA Virus Master (Roche Diagnostics, Mannheim, Germany) on z480 thermocycler (Roche Diagnostics) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM ß-mercaptoethanol) with cOmplete EDTA-free protease inhibitor tablet (Roche), 1 mM EDTA and 1 mM PMSF ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2024Quote: ... Aliquots (+Ab) were incubated with 5 µg antibody [anti-HA (3F10, Roche) or anti-MYC (AB9106 ...
-
bioRxiv - Immunology 2024Quote: ... glycerol 5% and half a tablet of protease inhibitor cocktail (complete, Roche)) ...
-
bioRxiv - Biochemistry 2024Quote: ... 5% glycerol supplemented with cOmplete EDTA-free protease inhibitor cocktail tablet (Roche) and Benzonase Nuclease (Merck) ...
-
bioRxiv - Genomics 2024Quote: ... and 5 μl KAPA Library Amplification Primer Mix (Roche, Catalog no. KK2623) to 20 μl Methyl CODEC library molecules ...
-
bioRxiv - Genetics 2024Quote: ... containing 5 M guanidine-HCl plus complete protease and phosphatase inhibitors (Roche). This resuspension (the guanidine HCl soluble fraction ...
-
bioRxiv - Systems Biology 2024Quote: ... Reactions were setup with 5 μL KAPA Hifi 2X Readymix (Roche KK2601), 1 μL forward primer (.3μM) ...
-
bioRxiv - Cell Biology 2024Quote: ... for 5 min and stained with 0.5 µg/ml DAPI (10236276001; Roche) for 5 min before embedded in PPDI [20 mM HEPES (pH 7.4) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos underwent blocking with 1:5-diluted Western Blocking Solution (Roche) for 1 hour at room temperature under agitation ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg gDNA of each population was amplified using the KAPA HiFi ReadyMix PCR Kit (Roche) with the TKO outer Fw and Rv primers (Primers are listed in Supplementary Table 4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification with 21 cycles was conducted by adding 3 µL KAPA HiFi HotStart ReadyMix (Roche) and 0.05 µL IS PCR primer (10 µM ...
-
bioRxiv - Cell Biology 2024Quote: One million cells were initially lysed in 0.5% CHAPS (3-cholamidopropyl dimethylammonio 1-propanesulfonate) (Roche; #10810118001) in PBS (1x ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated overnight at 4 °C in MABB with anti-fluorescein POD (Roche) at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... lysates were incubated at 4 °C overnight with rabbit anti-GFP (1:1000, Roche) and pull down was performed with magnetic proteinA beads (Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mutants were extracted with PBS containing 4 mM digitonin and protease inhibitors (Roche).
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole; 10236276001, Roche, Basel, Switzerland) for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then incubated overnight at 4°C with an anti-GFP (ROCHE Anti-GFP ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DTT and 10 % (v/v) glycerol) supplemented with: cOmplete protease inhibitor (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4 °C in MABB with anti-DIG POD (Roche) at a 1:1,000 dilution ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche, 10236276001; 1:10,000) for 5 minutes ...
-
bioRxiv - Genomics 2024Quote: ... and incubated overnight at 4°C with Anti-Dig-AP antibody (Roche, 1:5000) in 1% lamb serum ...
-
bioRxiv - Biochemistry 2024Quote: ... tissues were lysed in RIPA buffer (ratio 1:4) supplemented with protease inhibitors (Roche) and protein was quantified by BCA Protein Assay Kit assay.
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was reverse-transcribed using 2.5×10-4 U/μl hexanucleotide mix (Roche), 0.4mM deoxynucleotide mix (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA was stained using DAPI (4′,6-diamidino-2-phenylindol-dihydrochloride) (Roche, Mannheim, Germany). Slides were examined using an Axio Imager 7.1 microscope (Zeiss ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested with digestion buffer (Gibco DMEM/F12, Fisher 11320033; 4 µg/ml Roche Collagenase/Dispase ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were blocked in blocking buffer comprised of 4% Bovine Serum Albumin (Roche, 10735087001) and 1% Triton X-100 in 1X PBS for 30 minutes at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell nuclei were labelled with 4’,6- Diamidin-2-phenylindol (DAPI, 1:1000, Roche Diagnostics GmbH ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 h in 1:1500 solution of anti-digoxigenin antibody (Roche, cat no. 11333089001):blocking solution ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma contamination was excluded by 4’,6-diamidino-2-phenylindole staining (Roche, Basel, Switzerland). Cell lines were authenticated by STR DNA profiling analysis (Leibniz Institute DMSZ ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µL egg extract was diluted in 16.5 µL reaction buffer (80 mM β-glycerophosphate, 20 mM EGTA, 15 mM MgCl2, 10 uM okadaic acid, 1x protease inhibitor (Roche, cOmplete #11873580001), 100 µM ATP ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylated human MIF was produced using D-biotinoyl- ε -aminocaproic acid-N-hydroxy-succinimide ester (Biotin-7-NHS) with the Biotin Protein Labeling Kit from Roche (Mannheim, Germany). Alternatively ...