Labshake search
Citations for Roche :
1201 - 1250 of 2356 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 0.5 mM CaCl2 and 1 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... then the beads were washed 3 × with washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 100 μM CaCl2 ...
-
bioRxiv - Genomics 2021Quote: ... we blocked the slides for 1-hr using 3% BSA/PBS with 0.1% Tween and incubated slides with 1:200 secondary antibodies (Roche) in 3% BSA/4X SSC with 0.1% Tween and BSA at room temperature for 1 hr ...
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mL of Tris (pH = 8.5) and 3 tablets each of the protease/phosphatase inhibitors PhosStop and Complete Mini (Roche). Tissues were then lysed in Precellys Homogenizer Bertin (program 6 x 20s pulse ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 μl of MNase buffer (0.3 M Sucrose, 85 mM Tris, 3 mM MgCl2, 2 mM CaCl2, 2.5U of micrococcal nuclease: Roche 10107921001) was added in to each tube (0.5 millions of cells per tube) ...
-
bioRxiv - Cancer Biology 2024Quote: ... nuclei were isolated from 5 million cells with hypotonic buffer (20 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, protease inhibitors (Roche)) for 15 min on ice ...
-
bioRxiv - Biochemistry 2024Quote: ... resuspended in lysis buffer (20 mM Tris-HCl, pH 7.5, 300 mM NaCl, 0.5 mM TCEP, 1× Benzonase, 3× protease inhibitor cocktail [Roche cOmplete]), and lysed using a cell disruptor at 1.5 kbar ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked with 3% BSA in HBSS buffer for 20 min and permeabilized with 0.1% Triton X-100 (Roche) in blocking buffer for another 20 min at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Phospho-Histone 3 IHC on murine tissues was performed on the Ventana Discovery ULTRA (version v12.31) (Ventana/ Roche) using hand-applied antibodies at the following concentrations ...
-
bioRxiv - Immunology 2021Quote: ... 5% Sarkosyl) and samples were treated with proteinase K (50μg/mL) and Ribonuclease A (Roche) for 30 minutes at 37°C to remove contaminating proteins and RNA ...
-
bioRxiv - Genomics 2020Quote: ... Cells were washed in 2X PIC (Roche mini-tabs, 1 tab in 5 ml = 2X) and stored at -80°C until needed.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM EDTA at pH 8) containing protease inhibitors (cOmplete mini EDTA-free tablets, Roche) for 30 mins on ice ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 0.25 μM gene-specific primers and 5 μl LightCycler 480 SYBR Green I Master (Roche) on a Roche LightCycler 480 II real-time PCR System according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with one EDTA-free protease inhibitor mini tablet / 5 ml of buffer (Roche #4693159001). Lysates were incubated on ice for 15 min ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.2% IGEPAL and 5 mM EDTA) and supplemented with a protease inhibitor cocktail (Roche diagnostics). Samples were centrifuged at 2,350 g for 10 min at 4°C and the supernatant was collected ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM sodium pyrophosphate) containing 0.05% PMSF and EDTA-free Complete protease inhibitor cocktail (Roche). Equal volume of acid washed 0.45 mm glass beads (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 5% glycerol) containing 100 mM Phenylmethylsulphonylfluoride (PMSF) and EDTA-free Protease inhibitor cocktail tablets (Roche). Resuspended cells were first treated with 1 mg/ml Lysozyme to digest the cell wall and subsequently frozen at −80°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... consisting of MS1 with 300 mg/L carbenicillin and 5 mg/L hygromycin (Roche, Germany) (YFT1-CDS) ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR reactions were prepared using 5 μL of FastStart SYBR Green Master mix (Roche Diagnostics) with a final concentration of 1μM of each primer ...
-
bioRxiv - Immunology 2020Quote: ... membranes were blocked in 5% BSA (BSA Fraction V; Roche Life Sciences, Almere, The Netherlands) in TBS-T or 5% milk in TBS-T for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM EDTA) and freshly added PMSF (1 mM) and Protease Inhibitor Cocktail (Roche #11836170001). Equal amounts of protein (30 μg ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Neuroscience 2021Quote: ... S.p.a) and midazolam (0,5 mg kg −1) (Dormicum®, 5 mg/ml, Roche Pharma, Switzerland) for IM premedication before the start of the procedure ...
-
bioRxiv - Biophysics 2020Quote: ... 5 mM MgCl2 (buffer B) containing 2 mM PMSF and Complete protease inhibitor cocktail (Roche). After centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were counterstained with 5 ng/ml of 4,6–diamidino-2-phenylindole dihydrochloride (DAPI; Roche). Coverslips were mounted on slides with Fluoromount G (Electron Microscopy Sciences ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA containing EEEb1 was labeled with cyanine-5-dUTP by Nick Translation Mix (Roche), while plasmid DNA harboring each of the other nine DNA families (EEEb2–EEEb10 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStar Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media was aspirated and minced tissue was digested with ∼5 mg of Collagenase P (Roche) in 5 mL cold HBSS for 15-20 minutes ...