Labshake search
Citations for Roche :
51 - 100 of 6114 citations for 7 Methoxy 9 methylphenazine 1 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... or pRetroX-Tet-On using X-tremeGENE 9 (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the cells were transfected using X-TremeGENE 9 (Roche) with the pLentiCRISPR plasmids and the lentiviral packaging plasmids pMD2.G and psPAX2 to generate lentiviral particles coated with the VSV-G protein and incubated overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 μL X-tremeGENE 9 DNA transfection reagent (Roche) and 500 μL Opti-MEM media (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus was generated by using Xtremegene-9 (Roche 06365787001) to co-transfect the scaffold-containing pLenti plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... 6 uL X-tremegene-9 transfection reagent (Roche 06365787001), 0.3 μg pCMV-VSV-G (Addgene Plasmid #8454) ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% deoxycholic acid) containing inhibitors of phosphatases (1:10 PhosphoStop; Roche) and proteases (1:100 Protease Inhibitor Cocktail ...
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Cell Biology 2019Quote: ... 1 x Protease Inhibitor cocktail ethylenediaminetetraacetic acid (EDTA)-free (PI, Roche), 10 mM NaF (Nacalai tesque) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Genetics 2023Quote: ... 1% Triton X-100 and 1× cOmplete™ ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche). After removal of cell debris by centrifugation (twice 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.3 % NP-40 and 1 x protease and phosphatase inhibitors, Roche, USA) by passing through a 23G needle and syringe 30 times and then left to stand on ice for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were transfected with Tau P301L-V5 encoding full length human tau with P301L mutation and V5 tag (GKPIPNPLLGLDST) and TFEB-GFP at a 2:1 ratio of tau:TFEB (X-tremeGENE 9, Roche). 24 hours later the media was changed and 40 µL of Pff was added to the culture along with 200 nM Bafilomycin (Sigma ...
-
bioRxiv - Genetics 2023Quote: ... 1×EDTA (Ethylene Diamine Tetraacetic Acid)-free protease inhibitor cocktail (Roche 04693132001). The larvae were then crosslinked by adding formaldehyde to a 1.8% concentration and incubating for 5mins at RT on a rotator ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 μg/ml insulin (Roche, #11376497001), and 15 mg/ml transferrin (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... or X-Treme transgene 9 transfection reagent (Roche, Basel, Switzerland), according to manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected using X-tremeGENE 9 transfection reagent (Roche). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell line using X-tremeGENE 9 DNA transfection reagent (Roche). 48 h after transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... using X-tremeGENE 9 DNA transfection reagent (Roche, cat# 6365779001) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and transfected 24 h later using Xtreme-GENE 9 (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded and transfected using XtrememGene 9 (Roche, USA) according to manufacturer’s manual 48 h prior to infection ...
-
bioRxiv - Cell Biology 2021Quote: ... pX330-based plasmids were transfected using X-tremeGENE-9 (Roche) together with a mCherry-expressing plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... containing AAVS1-targeting recombination arms [62] using XtremeGene 9 (Roche). Transfected cells were allowed to recover for 48 hrs before treatment with 1 μg/ml puromycin (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 24 h) using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.4 µg vsFULL envelope plasmid using Xtremegene-9 (Roche). After 16 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... media containing 24 μL of X-tremeGENE 9 DNA (Roche) and added to HEK cells ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1% deoxycholic acid and 1% Nonidet P-40 [NP-40]) containing protease inhibitor cocktail (Roche Diagnostics) and placed on ice for 30 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid DNA from the in vitro methylation reactions were transfected with 3 µL (Il33) or 1 µL (SV40) X-tremeGENE 9 transfection reagent (Roche) diluted in 50 µL of Opti-MEM medium (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... allowed to adhere overnight and transfected with the indicated splicing reporter constructs (1 µg/well) using X-tremeGENE 9 (Roche). As shown in the Key Resources Table ...
-
bioRxiv - Molecular Biology 2022Quote: Mouse pancreata from adult mice (9-14 week old) were perfused with a solution containing 1 mg/mL collagenase-P (Roche) in Hank’s buffered salt solution (HBSS ...
-
bioRxiv - Cell Biology 2023Quote: RPE-1 cells were trans-fected with the different Flag constructs for 48 h using X-tremeGENE 9 DNA reagent (Roche). Cells were lysed in 25mM Tris (pH 7.5) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM ethylenediaminetetraacetic acid (EDTA)) supplemented with an EDTA-free antiprotease tablet (Roche) and lysed by sonication ...
-
bioRxiv - Cancer Biology 2020Quote: ... Linoleic acid (C18) complexed with fatty acid free BSA (Roche 10775835001). PBS and BSA were used as the vehicle control in experiments containing C8 and C18 respectively ...
-
bioRxiv - Cell Biology 2022Quote: Cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche). To generate retroviral particles ...
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Genomics 2020Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche), and 24 hours later 8000 GFP+ cells were sorted into a well of six-well plate ...
-
bioRxiv - Genomics 2019Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche). 24 hours later ...
-
bioRxiv - Biophysics 2021Quote: ... and cells were transfected using the Xtreme-Gene 9 reagent (Roche) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...