Labshake search
Citations for Roche :
451 - 500 of 6114 citations for 7 Methoxy 9 methylphenazine 1 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Next embryos were washed in blocking solution (100mM maleic acid, 150 mM NaCl pH 7.5, 2% blocking reagent (Roche)) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Physiology 2021Quote: ... Trypsin activity was then inhibited by adding to the homogenate bovine serum albumin (BSA) fatty acid free (0.25 mg/mL) and protease inhibitor cocktail (PIC, Roche).
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... in complementary deoxyribonucleic acid (cDNA) from 10 ng total RNA in 10 μl reactions with 2× Master Mix (Roche) in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... L6 cells and cardiomyocytes by incubating them in their respective media containing 2% (w/v) fatty acid-free bovine serum albumin (FAF-BSA; Roche) and 0.4 mM sodium palmitate (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Molecular Biology 2021Quote: ... lysate supernatant from cells expressing N-terminal 6-His-tagged proteins were incubated with nickel-nitrilotriacetic acid (Ni-NTA) cOmplete His-tag purification resin (Roche) for 1 h at 4° C ...
-
bioRxiv - Biochemistry 2019Quote: ... washed in 15 ml of sucrose-MOPS buffer (250 mM sucrose, 20 mM 3-morpholinopropanesulfonic acid, pH 7.4, supplemented with complete EDTA-free protease inhibitors, Roche, Switzerland) and resuspended in 4 ml of sucrose-MOPS buffer ...
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...
-
bioRxiv - Immunology 2019Quote: ... Samples were washed in 1X maleic acid buffer with 0.1% Tween-20 (MBST) and then incubated in Roche Blocking Reagent (Roche, 1096176) with 10% heat inactivated sheep serum (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Viral transport media was added to each pool at a 1:1 ratio for nucleic acid extraction performed on the Roche MagNA Pure 24 platform using the MagNA Pure 24 Total NA Isolation kit (Roche). Elution volume was set to 50 ul to concentrate viral RNA ...
-
bioRxiv - Microbiology 2021Quote: ... was extracted from inactivated samples (200 μL) using the MagNA Pure Compact instrument and MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Molecular Systems Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was replaced with E6 medium (DMEM/F-12 supplemented with 64 mg/L L-ascorbic acid 2-phosphate magnesium, 14 µg/L sodium selenium, 543 mg/L sodium bicarbonate, mg/L insulin [Roche, Penzberg ...
-
bioRxiv - Microbiology 2019Quote: ... Sendai Virus (SeV) and Modified vaccinia Ankara (MVA)-gfp viral stocks were extracted using the High Pure Viral Nucleic Acid Kit (Roche). When indicated ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Neuroscience 2021Quote: ... Two AfeI restriction sites were sequentially added by two rounds of PCR-amplification on each side of individual IDR (see Fig. 1b and S1b for amino acid position) using KAPA HiFi polymerase (Roche). The PCR reaction was DpnI digested (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from 200 μl of another aliquot of lung homogenate supernatant using the MagNA Pure Total Nucleic Acid Isolation protocol and reagents on a MagNA Pure LC 2.0 instrument (Roche Diagnostics). Prior to extraction ...
-
bioRxiv - Microbiology 2020Quote: ... whole specimens were processed into head/thorax homogenates for RNA extraction with the High Pure Viral Nucleic Acid Kit (Roche), according to manufacturer’s instructions (Moreira et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Genomics 2019Quote: ... Samples were washed in 1X maleic acid buffer with 0.1% Tween-20 (MBST) and then incubated in Roche Blocking Reagent (Roche, #1096176) with 10% heat inactivated sheep serum (Sigma ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from homogenized tissue of adenovirus vectored vaccine inoculated mice by High Pure Viral Nucleic Acid Kit (Roche). DNA fragments of Sad23L and Ad49L vectors were amplified by nested PCR with primers specific to adenoviral hexon sequences (Table S4 ...
-
bioRxiv - Genomics 2022Quote: Cells were lysed in RIPA buffer (Beyotime, China) containing protease inhibitors (Complete Mini Ethylene Diamine Tetraacetic Acid-Free Protease Inhibitor Cocktail, Roche). The protein lysates were centrifuged ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids were spotted (for dot-blot) or electro transferred (for northern-blot) to positively-charged nylon membranes (Roche Diagnostics), and hybridized with DIG-labeled full-length riboprobes as previously described [8 ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids were spotted (for dot blotting) or electro-transferred (for Northern blot) to positively-charged nylon membranes (Roche Diagnostics), and hybridized with DIG-labeled riboprobes as previously described (22).
-
bioRxiv - Microbiology 2023Quote: ... and nucleic acid extracted using the MagNA 96 instrument with DNA/Viral NA small volume kits (Roche, Laval, Quebec, Canada). Ophidiomyces ophidiicola was not detected in these samples by qPCR (Allender et al ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 0.05% (v/v) Tween-20) and processed through the spin columns from High Pure Viral Nucleic Acid Large Volume kits (Roche, Switzerland). Purified DNA was eluted in either 45 µl of EB buffer (10 mM tris-hydrochloride (pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: ... DNA extractions performed at the MPI-SHH substituted the column apparatus from the High Pure Viral Nucleic Acid Large Volume Kit (Roche, Switzerland) in place of the custom assembled Zymo-reservoirs coupled to MinElute (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... three-to-four 5μm FFPE samples sections were taken for RNA extraction using commercial FFPE nucleic acid isolation kit (Roche Molecular Diagnostics). RNA was quantified using Nanodrop and analyzed for fragment distribution using a bioanalyzer (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... uric acid and phosphate) were analyzed and quantified by the Service de Chimie Clinique du CHUV using a Cobas 8000 (Roche Diagnostics).
-
bioRxiv - Biochemistry 2021Quote: ... the amino acid Thr at position 206 was mutated to Trp using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, USA) together with the designed complementary primers (5’- CCTATCTGATTCATGAGCACATGGTTATTTGGGATCGCATTGAAAAC-3’ and 5’- GTTTTCAATGCGATCCCAAATAACCATGTGCTCATGAATCAGATAGG-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM β-mercaptoethanol and 10% glycerol) plus 20 mM imidazole and supplemented with ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablets (Roche Diagnostics). Cells were lysed using a cell disrupter (Constant Systems ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: Viral RNA was extracted using the MagNA Pure 96 DNA and Viral Nucleic Acid kit on the MagNA Pure 96 system (Roche Diagnostics) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.6 mL of incubation buffer (citric acid 100 mM and NaCl 250 mM pH 5.5 with inhibitor cocktail (Roche, Rotkreuz, Switzerland) dilution according to the instructions of the manufacturer) ...
-
bioRxiv - Microbiology 2023Quote: RNA from specimens from Cyprus underwent automated total nucleic acid extraction using the MagNA Pure 96 DNA AND Viral NA Small Volume kit (Roche Diagnostics). RT-PCR for FCoV was performed at Laboklin Bad Kissingen ...
-
bioRxiv - Cancer Biology 2023Quote: ... resuspended at 10 mg/mL in AC/BT buffer (1.5M aminocaproic acid and 75mM Bis-Tris/HCl, pH 7.0, supplemented with Complete Mini Protease Inhibitor [Roche Diagnostics, Stockholm, Sweden]), and kept frozen at -80°C until analysis ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... but replaced the Zymo-Spin V column binding apparatus with a high pure extender assembly from the High Pure Viral Nucleic Acid Large Volume Kit (Roche 05114403001). Double-stranded Illumina libraries were prepared using the Blunt-End Single Tube (BEST ...