Labshake search
Citations for Roche :
51 - 100 of 7977 citations for 7 8 DIHYDRO 1 3 DIOXOLO 4 5 G ISOQUINOLIN 5 6H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Zoology 2023Quote: ... Single staining was performed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP; 1:50 dilution in alkaline buffer; Roche Diagnostics). The cells were then stained overnight at room temperature.
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... and the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 4-nitroblue tetrazolium chloride (NBT) (Roche Diagnostics). After washing ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 5% glycerol) per 1 L of cells with one EDTA-free protease inhibitor cocktail tablet (Roche). Cells were lysed using a Misonix Sonicator 3000 (110 W for 2 min total ON-time ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Neuroscience 2019Quote: ... BCIP (5-Bromo-4-chloro-3-indolyl-phosphate, 4-toluidene salt, Roche, Cat. No. 11 383 221 001. 105 µl/40 ml) and Levamisole (Vector ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl RNase A (2.5 g, DNase-free, Roche #11119915001) or dH2O ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Microbiology 2021Quote: ... employing 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) and nitro blue tetrazolium (NBT) as substrates (RocheR, Roche Applied Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... the alkaline phosphatase activity was detected by using nitroblue tetrazolium chloride (337.5μg/ml) and 5-bromo-4-chloro-3-indolyl phosphate (175μg/ml) (Roche Diagnostics). Sections were mounted in Mowiol.
-
bioRxiv - Developmental Biology 2019Quote: ... and stained with standard Nitro Blue Tetrazolium (NBT) and 5-Bromo-4-chloro-3-indolyl phosphate (BCIP) (Roche) ISH protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were harvested and incubated in buffer A (50 mM MMT pH 8.0/300 mM KCl/10 mM MgCl2/5 % glycerol) containing 1 g L-1 lysozyme/2.5 U mL-1/SmDNAse//complete protease inhibitor cocktail (Roche) for 1 h prior to lysis using EmulsiFlex C5 (Avestin ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 mM imidazole) and one tablet “cOmplete” protease inhibitor cocktail (Roche, www.sigmaaldrich.com). The cells were lysed and homogenized by ultrasonification and French Press® disintegration ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... and then reacted with 0.375 mg/mL nitroblue tetrazolium and 0.188 mg/mL 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP; Roche Diagnostics) for 27—42 h.
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Cell Biology 2023Quote: ... 50 mM Tris pH 8, 450 mM NaCl, 1% CHAPS, 20 mM MgCl2, 5 mM ATP, 1 mM Dithiothreitol [DTT], 1X Roche Protease Inhibitor Cocktail ...
-
bioRxiv - Genomics 2019Quote: ... the 5’ end of the Ppetra cDNA was determined with the 5’/3’ RACE kit 2nd generation (Roche). Reverse transcription was performed as recommended by the suppliers ...
-
bioRxiv - Immunology 2019Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) or 20 μM nigericin (N-7143 ...
-
bioRxiv - Immunology 2020Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) for 45 min were used as positive controls for caspase-1 and IL-1β blots ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5) Incubated with 50μL of TUNEL reaction mixture for one hour (Roche protocol); 6 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene expression signals were visualized using nitroblue tetrazolium/5-bromo-4-chloro-3-indolylphosphate solutions using a standard method (Roche). Whole-mount and sectioned specimens of Ciona were observed using an SZX12 stereo microscope (Olympus ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by visualization with nitro blue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Roche Diagnostics, Basel, Switzerland). Embryos were imaged using a Leica M205 FA epifluorescence microscope (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were subsequently incubated in the dark on a slow rocker in dilutions of Nitro-blue tetrazolium/5-bromo-4-chloro-3-inodyl phosphate (NBT/BCIP; Roche) in TBST ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of DIG-probes was made in staining buffer (in 10% polyvinyl alcohol) supplemented with nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate (BCIP) (Roche). In addition ...
-
bioRxiv - Genetics 2022Quote: ... Expression patterns were visualized with a Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3-Indolyphosphate p-Toluidine Salt (NBT/BCIP) system (Roche). Sections were mounted with Vectamount (Vector laboratories ...
-
bioRxiv - Developmental Biology 2019Quote: ... and then incubated at room temperature in the same solution containing NBT-BCIP (nitrotetrazolium blue chloride at 350 µg/ml and 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt at 175 µg/ml) (Roche) until the color appeared ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Cell Biology 2021Quote: ... Cardiac tissue sections were either stained for 5-bromo-4-chloro-3-indolyl-b-galactosidase (Xgal; Roche Cat #XGAL-RO) or immunostained with rabbit anti-mouse polyclonal Ror2 (provided by Dr ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was washed again with 1x TBST 3-5 times for a total of 20 min and developed using 5-bromo-4-chloro-3-indolylphosphate (BCIP)/ nitro-blue tetrazolium (NBT) (Roche) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Hybridised probes were detected with anti-DIG antibodies and revealed with alkaline phosphatase-conjugated antibodies in presence of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Neuroscience 2022Quote: ... Alkaline phosphate labeling was detected by incubation overnight at room temperature in the dark with a nitroblue tetrazolium plus 5-bromo-4-chloro-3 indolyl-phosphate mixture (Roche) with levamisole (Sigma) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% Tween 20 in water) and incubated in NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) solution (Roche).
-
bioRxiv - Neuroscience 2023Quote: ... slides were incubated at 37oC in a staining solution containing nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) for 20-24 hours ...
-
bioRxiv - Pathology 2023Quote: ... Bound alkaline phosphatase was visualized with nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP; 11681451001, Roche). The reaction was stopped by incubation in buffer 4 (10 mM Tris and 1 mM EDTA ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 1 mM ATP, 1% IGEPAL, 5% glycerol, 3 U/ml Benzonase and Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Neuroscience 2020Quote: ... 40 mM KCl, 5 mM EGTA, 5 mM MgCl2, 5 mM DTT, 1 mM PMSF, 1% Triton X, protease inhibitor Roche complete, pH 7.2) and sonicated at low power for 5 s ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets of harvested bacteria were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...