Labshake search
Citations for Roche :
401 - 450 of 7977 citations for 7 8 DIHYDRO 1 3 DIOXOLO 4 5 G ISOQUINOLIN 5 6H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... 5% glycerol) supplemented with protease inhibitor cocktail (Roche). Lysates were incubated with GFP-Trap magnetic agarose beads (Chromotek ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 μl SYBR Green PCR master mix (Roche) and ultrapure water up to 10 μl was used and analyzed using the LightCycler 480 System (Roche) ...
-
bioRxiv - Pathology 2021Quote: ... 5 μl of PCR DIG labelling mix (Roche), 3 μl template DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 U/mL rabbit pyruvate kinase (Roche Diagnostics), 8 U/mL lactate dehydrogenase (Sigma-Aldrich)) ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 mM DTT and 1X protease inhibitor (Roche). Loose chromatin was removed with 1% SDS prior to sonication on a Bioruptor™ (Diagenode) ...
-
bioRxiv - Genetics 2020Quote: ... 5 mM EDTA with protease inhibitor cocktail (Roche), incubated at 4 °C for 30 min followed by centrifugation at 14000 rpm for 30 min to collect the supernatant ...
-
bioRxiv - Immunology 2022Quote: ... including 5% Western Blocking Reagent Solution (#11921673001, Roche) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM EDTA with protease inhibitors (11697498001, Roche)) by sonication using TAITEC VP-5S sonicator (output ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... 5 mM EDTA] containing protease inhibitor (Roche, 11836153001) and 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Genetics 2022Quote: ... in 5% blocking solution (Roche, cat. no.11096176001) at room temperature overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM DTT and 1x Protease inhibitor (Roche)) ...
-
bioRxiv - Genetics 2023Quote: ... and 5 µL 2x KAPA HiFi ReadyMix (Roche). The following indexing primers were used (X indicates the positions of the 8 bp indices):
-
bioRxiv - Genetics 2023Quote: ... 5 µL KAPA HiFi HotStart ReadyMix (KAPA Biosystems) and 1.8 µL H2O HyPure ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 U/mL deoxyribonuclease I (Roche 1010459001)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and laminin at 5 μg/ml (Roche # 11243217001). Cells were cultured in the presence of differentiation factors for 40 days ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 U/ml dispase II (4942078001, Roche). Hydrogels were seeded at a concentration of 500 cells per 200 μL gel (2.5 cells/μL) ...
-
bioRxiv - Plant Biology 2023Quote: ... and 5 µg/mL DAPI (Cat# 10236276001, Roche).
-
bioRxiv - Microbiology 2024Quote: ... 5 µg/mL DNAse and protease inhibitors (Roche) and lysed by sonication ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µg/mL DNAse and protease inhibitors (Roche). Lysate was incubated with 1% N-Dodecyl-β-D-maltoside for 1 hour at 4°C with mixing and then spun down at 20,000g for 20 minutes at 4°C to remove cell debris ...
-
bioRxiv - Neuroscience 2024Quote: ... midazolam (5 mg/kg body weight; Dormicum, Roche) and medetomidine (0.5 mg/kg body weight ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM magnesium chloride and protease inhibitors (Roche). A FastPrep-24 (MP Bio ...
-
bioRxiv - Cell Biology 2024Quote: ... treated with 5 μg/mL Proteinase K (Roche) and post-fixed in 4% (vol/vol ...
-
bioRxiv - Developmental Biology 2024Quote: ... + 5% SDS + 2x cOmplete protease inhibitor cocktail (Roche). After centrifugation at 14k rpm for 10 min at RT ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... expression vectors were co-transfected into HEK293T cells with the lentiviral packaging constructs psPAX2 and pMD2.G (VSV-G) in a 1:1:1 ratio using X-tremeGENE9 DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... expression vectors were co-transfected into HEK293T cells with the lentiviral packaging constructs psPAX2 and pMD2.G (VSV-G) in a 1:1:1 ratio using X-tremeGENE9 DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then treated with DNase-free RNase (Roche; 5 μg.ml-1; 37°C; 30 min) and proteinase K (250 μg.ml-1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5% (v/v) glycerol and 1 mM TCEP containing an EDTA-free protease inhibitor tablet (Roche). The cell suspension was sonicated on ice and clarified by centrifugation at 27,000g for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... The membranes were blocked for 1 hour at room temperature with 5% blocking agent (Roche Diagnostic) in TBST (100 rpm shaker) ...
-
bioRxiv - Cancer Biology 2023Quote: Du145 (5 × 103) and 22Rv1 (1 × 104) cells were seeded on 96-well E-Plates (Roche). Proliferation was monitored every 1 h and time dependent cell index (CI ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 7.5 supplemented with 5 mM dithiothreitol (DTT) and 1 x cOmplete protease inhibitor cocktail (Roche)) per gram of wet cell paste and incubated for 1 h at 4°C under stirring ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM imidazole] containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Complete™; Roche), and recombinant proteins were purified by immobilized metal affinity chromatography (TALON ...
-
bioRxiv - Biochemistry 2024Quote: ... in 5 % BSA in room temperature for 1 hour followed by 2.5 ug/ml DAPI (Roche) for 20 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μL of each forward and reverse primers (5 pM) and 5 μL of 2X FastStart SYBR Green master mix (# 6924204001, Roche, USA). The PCR cycling condition set in Light Cycler 480 instrument (Roche Diagnostics ...
-
bioRxiv - Systems Biology 2023Quote: ... HepG2s were washed once with 1X PBS then lysed in SDS lysis buffer (50 mM Tris HCl/2% SDS/5% glycerol/5 mM EDTA/1mM NaF/dH2O) supplemented with cOmplete Protease Inhibitor Cocktail Tablets (Roche #11836170001), Phosphatase Inhibitor Cocktail 2 (Sigma-Aldrich® #P5726) ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 μl papain inhibitor solution containing 5 mg/ml BSA (Carl Roth, 8076.4) and 5 mg/ml Trypsin inhibitor (Sigma-Aldrich/Roche, 10109878001) in PBS was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nuclei were pelleted at 1350xg for 5 min at 4°C and lysed in 5 mL LB2 (10 mM Tris-Cl pH 8.0, 5 M, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1 mM PMSF, Roche protease inhibitors) for 10 min at RT with rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-SPD-5 (1:1000, a generous gift from B. Bowerman, Hamill et al., 2002) and anti-GFP (1:500, Roche) overnight at 4°C and with secondary antibodies Alexa488 (1:500 ...
-
bioRxiv - Biochemistry 2021Quote: Cell extracts were prepared in 1% NP40 lysis buffer (20 mM Hepes pH 7.5, 150 mM NaCl, 1% NP40, 50 mM NaF, 1 mM Na3VO4, 10% glycerol, and protease inhibitor cocktail from Roche) at 4 °C for 15 mins ...
-
bioRxiv - Microbiology 2022Quote: ... The total qPCR reaction volume was 1.5 □μL with 0.5□ μl of DNA (40□ng□μl-1) and 1□μL of LightCycler 480 SYBR Green I Master mix (Roche) containing 0.5□μM of PCR primers ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed with protein lysis buffer (50 mM Tris-HCl, 250 mM NaCl, 5 mM EDTA, 1 mM Mg2Cl, 1% NP40 and supplemented with protease inhibitor cocktail, Roche), incubated on ice for 20 minutes and spun at 10,000 g for 10 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were lysed with protein lysis buffer (50 mM Tris-HCl, 250 mM NaCl, 5 mM EDTA, 1 mM Mg2Cl, 1% NP40 and supplemented with protease inhibitor cocktail, Roche), incubated on ice for 20 minutes and spun at 10,000 g for 10 min at 4 °C ...
-
bioRxiv - Plant Biology 2024Quote: The pulverized tissue was incubated in 30 mL of buffer 1 (400 mM sucrose, 10 mM Tris-HCl pH 8.0, 10 mM MgCl2, 5 mM β-mercaptoethanol, 1 mM PMSF, 1× Roche cOmplete EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Microbiology 2020Quote: ... and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland).
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The cross-linking reaction was quenched by incubating the cells with 0.125 M glycine for 5 min with mild agitation at room temperature followed by centrifugation at 3,000 rpm for 5 min at 4°C with a subsequent PBS wash (containing 0.01X protease inhibitor cocktail or PIC; #11836170001, Roche Applied Science, Indianapolis, USA). Following the complete removal of PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% SDS, 1 mM EDTA, 1 mM DTT, 1 mM Na3VO4×2H2O, 5 µM pepstatin A, 10 µM leupeptin, 2X Roche protease inhibitor cocktail), 200µl glass beads were added ...