Labshake search
Citations for Roche :
901 - 950 of 1846 citations for 4' O beta Glucopyranosyl 5 O methylvisamminol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Du145 (5 × 103) and 22Rv1 (1 × 104) cells were seeded on 96-well E-Plates (Roche). Proliferation was monitored every 1 h and time dependent cell index (CI ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 7.5 supplemented with 5 mM dithiothreitol (DTT) and 1 x cOmplete protease inhibitor cocktail (Roche)) per gram of wet cell paste and incubated for 1 h at 4°C under stirring ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM EDTA pH 8.0) with 1X complete protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche 11697498001) by vortexing ...
-
bioRxiv - Biochemistry 2024Quote: ... End point cell proliferation was assayed with ELISA 5-bromo-2′ -deoxyuridine (BrdU) kit from Roche Diagnostics (Sigma– Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µl of purified DNA is processed using the KAPA HyperPlus kit (Roche Sequencing, CA, USA) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM DTT and 1× cOmplete™ EDTA-free Protease Inhibitor Cocktail (Cat. No. 4693132001, Roche)) ...
-
bioRxiv - Microbiology 2024Quote: ... 0.3% Tween-20 pH 7.5) for 5 min at 37°C and blocking solution (#11585762001, Roche) for 45 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: PCLS (4mm diameter) were incubated (37°C, 5% CO2) with 10µL of WST-1 reagent (Roche) in 100µL of culture media for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated for 1 hour at 37⁰C and 5% CO2 with 10U DNase (Roche) in R10 medium (RPMI 1640 medium containing GlutaMAX from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... tissue sections were thawed at room temperature for 30 min and blocked with 5% BSA (Roche) + 0.2% Tween 20 (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 µl qPCR reactions were used for qPCR: 5 µl SYBR Green I Master Mix (Roche), 0.5 µl of 10 µM forward and reverse primer (final concentration 0.5 µM each primer) ...
-
bioRxiv - Biophysics 2024Quote: ... and 5 mM ATP) containing an ATP regeneration system [0.1 mg/mL pyruvate kinase (10109045001, ROCHE) and 2.5 mM phosphoenolpyruvate (860077 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001). The supernatants were collected and the beads washed (50μL ...
-
bioRxiv - Neuroscience 2021Quote: ... participants were given either a total of 225mg of L-DOPA (Madopar, Roche, Levodopa/Benserazid, 4:1 ratio) or a placebo (P-Tabletten white 8mm Lichtenstein ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with siRNAs or plasmid DNAs using Dharmafect 4 (Dharmacon) or Fugene 6 (Roche Applied Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were then probed overnight at 4℃ in anti-GFP (mouse monoclonal IgG1κ, cat#: 11814460001 Millipore Sigma/Roche) diluted 1:1000 in 5% Applichem nonfat dried milk in TBS-T ...
-
bioRxiv - Microbiology 2021Quote: ... The total qPCR reaction volume was 25 μl and consisted of 4 μl DNA (2,5 ng μl-1) and 12,5 μl LightCycler 480 SYBR Green I Master mix (Roche) containing 0.2 μM PCR primer (Table S5 ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were stained with NBT (Nitroblue tetrazolium) and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland) in developing solution at 37°C for 2 hrs ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Genetics 2022Quote: ... Overnight incubation with Anti-Dig antibody conjugated to alkaline phosphatase (1:5,000) at 4 °C (no. 11093274910; Roche) was followed by 8 × 30 min washing steps at room temperature with TBST 2 (TBST with 0.1% Tween 20 and 0.05% levamisole–tetramisole ...
-
bioRxiv - Cell Biology 2022Quote: ... before being detached with 40 μL of ice-cold native lysis buffer (80 mM PIPES pH 6.9, 2 mM MgCl2, 4 mM EGTA, 0.2% saponin, 5x cOmplete protease inhibitor cocktail Roche). The lysate was collected in 1.5 mL tube and incubated on ice for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were incubated with 4′,6-diamidino-2-phenylindole (DAPI; F. Hoffmann-La Roche, Natley, NJ, USA) and appropriate donkey anti-mouse/rabbit/rat/chicken secondary antibodies conjugated to Alexa Fluor 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... we labeled cell nuclei with DAPI (4’,6-diamidino-2-phenylindole; 1:10.000, Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Immunology 2020Quote: ... 1 μM of each primer combination and 4 μL of Lightcycler FastStart DNA MasterPLUS SYBR Green I (Roche) in a total volume of 20 μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Cell Biology 2021Quote: ... was homogenized and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and chromatin was extracted overnight at 4°C in 0.5X PBS (67.5 mM NaCl) with a protease inhibitor cocktail (Roche) on an end-over-end rotator ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were incubated at 37°C for 3-4 h before adding DNase I (0.1 U/µl) (Roche) and incubating for another 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with DNAse I (4 U/ul) and 1 cOmpleteTM mini EDTA-free protease inhibitor cocktail tablet (Roche). The sample was lysed by French press at 17 KPsi (Constant Systems Ltd) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections on slides were post-fixed at 4% PFA in 0.1M PB and treated with proteinase K (Roche). Sections were hybridized with digoxigenin (DIG)-labeled probes at 72°C overnight in hybridization solution ...
-
bioRxiv - Physiology 2023Quote: ... Tissues were chopped with scissors and digested in a cocktail containing 4 units/mL LiberaseTM (Roche; Catalog# 355374) and 0.744 units/mL Elastase (Worthington Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 8.5 was added and this reaction was treated with 4 Units of Alkaline Phosphatase (Roche Life Science) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 mM NaCl, 4 mM MgCl2, 2 mM DTT, 1% SDS, 0.5% sodium deoxycholate, 0.5% Igepal, supplemented with Roche Complete Protease Inhibitor cocktail (1 tablet/50 mL)) ...
-
bioRxiv - Immunology 2024Quote: ... colonic biopsies (n=3-4 per patient) were enzymatically digested using 0.5 Wünsch units/ml Liberase TM (Roche) and DNase I at 10µg/ml at 37°C (a protocol previously optimized in our lab)(43) ...
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM β-Mercaptoethanol) supplemented with 1 mM PMSF and cOmplete EDTA-free protease inhibitor cocktail (Roche) and lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM ß-mercaptoethanol (BME)) supplemented with 1 mM phenylmethylsulfonyl fluoride and 10 μg/mL DNase (Roche). The resuspension was processed with an Emulsiflex-C5 homogenizer (Avestin) ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Biochemistry 2021Quote: ... the presynaptic filament was formed by incubating 5 μl of streptavidin-coated magnetic resin (Roche Molecular Biochemicals) with 5’-biotinylated 80-mer ssDNA oligonucleotide (5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... for 5 minutes and cells were washed in cold PBS supplied with protease inhibitor cocktail (11873580001, Roche). Cells were stored as dry cell pellet at -80°C until further processed ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked in 5% skimmed milk and probed with anti-HA (Roche anti-HA-HRP 3F10), anti-Myc mouse monoclonal antibodies (Roche ...
-
bioRxiv - Immunology 2022Quote: ... 0.5% Na-deoxycholate) supplemented with 5 mM diisopropylfluorophosphate (DFP) in addition to the protease inhibitor cocktail (Roche). Cell scrapper was used to ensure optimal recovery of cell lysate ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of the enriched phage pools (50 μL reactions) and a high-fidelity phusion polymerase (Roche) were used for the PCR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were blocked by incubation in 5% (w/v) milk power or 1 × Western Blocking Reagent (Roche) in Tris-buffered saline and 0.1% (v/v ...