Labshake search
Citations for Roche :
701 - 750 of 1846 citations for 4' O beta Glucopyranosyl 5 O methylvisamminol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Microbiology 2023Quote: ... The cells were then washed 4 times in wash buffer containing 25% formamide (Roche, 11814320001), 2x SSC (Ambion ...
-
bioRxiv - Developmental Biology 2022Quote: ... The sections were deparaffinized and rehydrated before digestion with proteinase K (4 μg/ml; Roche) for 15 min at 37℃ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were subsequently fixed with 4% paraformaldehyde (PFA) and labelled with TUNEL (Roche, cat# 11684795910). Cells were then immunostained (1:2000 ...
-
bioRxiv - Biochemistry 2023Quote: ... diluted in 100 mM ammonium acetate (pH = 4) and digested with Glu-C protease (Roche) at 10:1 protein:enzyme for 1 h at room temperature prior to mass spectrometric analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... embryos were incubated overnight at 4°C with anti-digoxigenin antibody (1:5000, Roche 11093274910). Following several washes to remove excess antibodies ...
-
bioRxiv - Pathology 2024Quote: ... sections were incubated with 4′,6-diamidino-2-phenylindole (DAPI) (Roche Diagnostics GmbH, Mannheim, Germany) for 10 minutes to visualize cell nuclei ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 µM MgSO4 and the protease inhibitor cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Cells were then sonicated and the mixture was clarified by centrifugation ...
-
bioRxiv - Biochemistry 2024Quote: ... Lysates were subjected to end-on rotation at 4 °C with anti-GFP (Roche, 11814460001) or anti-FLAG (Merck ...
-
bioRxiv - Biophysics 2024Quote: ... PCR reactions were performed as follows: 4 µL of KAPA HiFi HiFi HotStart ReadyMix (Roche) was assembled with 1.6 µL of 1:10 bacteria dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... All steps were performed at 4°C and in the presence of Protease inhibitors (Roche) and 1mM TSA in every buffer to prevent protease and HDAC activity ...
-
bioRxiv - Cancer Biology 2021Quote: ... proliferation was measured using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells were pulsed with 10μM BrdU ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and protease inhibitor cocktail (Roche cat. no. 04693124001) and phosphatase inhibitor (Roche cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Neuroscience 2021Quote: Zebra finches received intramuscular (I.M.) injections of 2-Bromo-5’-deoxyuridine (BrdU; Roche Diagnostics) in 0.05 M tris buffered saline (TBS ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol with protease inhibitors (Roche, 1 tablet per 10 mL lysis buffer). Worm slurry was frozen in liquid nitrogen and stored at -80 °C until lysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... in an IP buffer (1xPBS, 5% glycerol, 0.5 mM EDTA, 1mM PMSF, 1x Roche cOmplete™Protease Inhibitor Cocktail ...
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was incubated at 55 °C overnight with 5 µL proteinase K (Roche). Genomic DNA was extracted with phenol:chloroform extraction.
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and supplemented with 5 mM CaCl2 and 15 units of S7 micrococcal nuclease (Roche). Lysates were sonicated for 10 seconds at low power followed by incubation on ice for 30 minutes and clarification by centrifugation at 13,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 hours incubation in MTSB containing 2 % BSA containing either an anti-GFP (Roche) or an anti-PIN1 monoclonal antibody at 0.1 % ...
-
bioRxiv - Plant Biology 2021Quote: ... in a total volume of 5 µL and analyzed on a Lightcycler 480 (Roche). Each reaction was done in three technical and three biological repeats ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA, mouse monoclonal primary antibody (12CA5 Roche, 5 mg/ml) at a dilution of 1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2021Quote: Using serum-free media supplemented with 5 g/l BSA fraction V (Roche, #107351080001), islets were pre-treated with 100 nM CCK ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM β-mercaptoethanol and the EDTA-free complete ULTRA protease inhibitor cocktail (Roche). Proteins were batch-purified using Ni-NTA agarose resin (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... Mouse tail epidermis was separated from dermis by 5 mg/ml Dispase II (Roche) digestion in 37°C for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... 300 nM gene-specific primers and 5 µL SYBR Green Mix (Roche, Mannheim, Germany). Amplification was done using StepOneTM Real-Time PCR System according to the manufacturer’s description (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 5 mg/ml 41,6-diamidino-2-phenylindole (DAPI; Roche, 1023627600) in PBS for 1 min and coverslips were mounted onto SuperFrost® Plus slides (R ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... supplemented with 5 mM DTT and a protease inhibitor cocktail (Complete EDTA-free, Roche). Spores were transferred to tubes containing Lysing Matrix E (MP Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% glycerol) supplemented with protease and phosphatase inhibitors (1X EDTA-Free inhibitor cocktail (Roche), 1 mM PMSF ...
-
bioRxiv - Physiology 2020Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP-40 and 5% glycerol) supplemented with protease inhibitors (Roche Complete EDTA-free). Protein concentrations were determined by bicinchoninic acid assay (BCA protein assay kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from lysed cells was removed using 5 μl RNAse-free DNAse I (Roche) for every 1 ml dissociate and incubated at 37°C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM EDTA and EDTA-free Protease Inhibitor Cocktail tablets (Roche AG, Basel, Switzerland). Cell debris was removed by centrifugation (4 °C) ...
-
bioRxiv - Immunology 2020Quote: ... About 2-5 μg of RNA were treated with DNAseI (Roche Diagnostics, Laval, QC) according to the product manual ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of total RNA were treated with recombinant DNase I (Roche Diagnostics Ltd) at 37°C for 30 min and then purified using a standard phenol–chloroform method ...
-
bioRxiv - Cell Biology 2023Quote: ... for 5 minutes and hiPSC-CMs were dissociated using 1:200 Liberase TH (Roche) in PBS for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% nonfat dry milk and proteins detected using monoclonal anti-GFP (Roche), monoclonal anti-PGK (Invitrogen) ...
-
Transcriptional analysis in multiple barley varieties identifies signatures of waterlogging responsebioRxiv - Plant Biology 2023Quote: ... Each PCR reaction mix contained 5 μL of 2x SYBR green master 1 (Roche), 1 μL cDNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The 10 μl PCR mixture consisted of 5 μl KAPA2G Robust HotStart ReadyMix (Roche), 1 μl molecular grade water ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 5 minutes on ice and re-suspended in DPBS with Protectorase (Roche #3335402001) and Superase (Invitrogen #AM2694 ...
-
bioRxiv - Microbiology 2024Quote: ... using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems, Wilmington, MA), 0.3 mM of each primer and 1 µL of DNA template (20 ng µL-1) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM EDTA) supplemented with 1 mM PMSF and protease inhibitor cocktail (Roche #11836170001). To ensure complete lysis ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM EDTA) supplemented with a protease inhibitor cocktail (Complete, Roche Applied Science, #11836153001) and phosphatase inhibitors (PhosSTOP Sigma #04906837001) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mg/mL DNaseI (Gold Biochem) and a single “Complete” protease inhibitor tablet (Roche). Cells were lysed by sonication and the lysate clarified by centrifugation and applied to glutathione agarose (1 mL bed volume ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 5 µl of X-tremeGENE 9 transfection reagent (XTG9-RO Roche, Sigma-Aldrich). Three days after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM ethylenediaminetetraacetic acid (EDTA)) supplemented with complete EDTA-free protease inhibitor cocktail (Roche), 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Genomics 2022Quote: ... We then added 5 μL of KAPA Unique Dual-Indexed Adapters (Roche, cat # 08861919702) diluted to 750 nM ...