Labshake search
Citations for Roche :
851 - 900 of 7686 citations for rno mir 16 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... RT–qPCR was performed in a LightCycler PCR instrument (Roche) using SYBR Green Master Mix (Roche).
-
bioRxiv - Genetics 2023Quote: ... RT-PCR was performed using KAPA HiFi HotStart ReadyMix (Roche) under conditions that resulted in 1% of the concentration of the original cDNA solution ...
-
bioRxiv - Immunology 2023Quote: Quantitative RT-PCR was performed on LightCycler 480 II (Roche) using TaqMan gene expression assay (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cDNAs of RBP (head/thorax) of individual mosquitoes composing each pool were screened by real-time PCRs on a LightCycler® 480 (LC480) (Roche Applied Science, Germany). Real-time PCR assay targeting the virus of interest (see primers/probe sets in Table 7 ...
-
bioRxiv - Microbiology 2021Quote: ... First-strand cDNA synthesis and quantitative real-time PCR were performed with KAPA SYBR® FAST (CliniSciences, Nanterre, France) on the LightCycler 480 (Roche Diagnostics, Meylan, France) using the primers indicated in Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was conducted using Roche SYBR-Green® master mix and a LightCycler 480 II Real-Time PCR system (Roche Applied Science, Penzberg, Germany). For analysis ...
-
bioRxiv - Microbiology 2020Quote: ... HBV DNA (rcDNA and cccDNA) and RNA (pregenomic RNA, pgRNA) were quantified by real-time PCR on a LightCycler™ instrument (Roche Diagnostics, Mannheim, Germany) using specific PCR primers as described (Lucifora ...
-
bioRxiv - Microbiology 2022Quote: ... quantitative RT-PCR (qRT-PCR) was carried out using a Light-Cycler 480 (Roche, France). As internal controls for mRNA quantification ...
-
bioRxiv - Biochemistry 2023Quote: ... Probe detection was performed using the DIG luminescent detection kit (Roche, Penzberg, Germany) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and Southern hybridization with blaKPC and rep IncFIIK DIG-labelled probes (16) prepared using published primers (35,36) and the PCR DIG Probe Synthesis Kit (Roche, Mannheim, Germany) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... ATAC-Seq libraries were generated from transposed DNA using the Kapa Biosystems Real-Time Library Amplification kit (Kapa Biosystems, Cat. 07959028001) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The detection kit for the antibodies is the UltraView DAB detection Kit (Ventana Medical Systems Inc./ Roche Diagnostic). A counter-staining of the nuclei was used for 12 minutes by Hematoxylin ...
-
bioRxiv - Molecular Biology 2019Quote: ... Diluted extracts were amplified in 12 parallel reactions using the Transcriptor One-step RT-PCR kit (Roche, Basel, Switzerland) for reverse-transcription and first-round PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... and quantitative RT-PCR for library quantification was performed using the Kapa Library Quantification Kit (Roche Sequencing, Pleasanton, CA). The libraries were sequenced on the Illumina NextSeq 500 v2 sequencer with a 75-base paired-end run in order to generate about 40 million read pairs per sample.
-
bioRxiv - Molecular Biology 2020Quote: A total of 4 chemosensory-related transcripts identified by RNA-seq to be expressed deferentially between forelegs and hindlegs were selected for real-time quantitative PCR (qPCR) analysis using the LightCycler® (Roche Applied Sciences, Mannheim, Germany). RNA extraction was performed as mentioned above ...
-
bioRxiv - Genomics 2022Quote: ... Clone probes were PCR labelled with biotin-16-dUTP (from Roche Applied Science). Hybridization was performed over-night ...
-
bioRxiv - Pathology 2020Quote: ... DAB Map detection kit (Roche Diagnostics KK) was used for visualization ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cytotoxicity detection kits were purchased from Roche Diagnostics Ltd (West Sussex ...
-
bioRxiv - Immunology 2022Quote: Cytotoxicity Detection LDH Kit (Roche, Indianapolis, USA) was used on cell supernatants according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the HNPP/FastRed detection kit (Roche). Immunohistochemistry against cell type-specific markers and detection of proliferating cells was carried out subsequently to HNPP detection.
-
bioRxiv - Molecular Biology 2019Quote: ... and the Cytotoxicity Detection Kit (Roche, Germany). Amplex® Red Cholesterol Assay Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: in situ Cell Death Detection Kit (Roche) was used for evaluation of cell apoptosis.
-
bioRxiv - Neuroscience 2023Quote: ... The UltraView Universal DAB Detection Kit (Roche) was used for detection and counterstaining was performed with hematoxylin for 4 min ...
-
bioRxiv - Bioengineering 2023Quote: LDH Cytotoxicity Detection Kit plus (Roche Diagnostics) was used to quantify U2OS cell death on day 1 and day 7 of cell culture ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Real-time quantification was performed using SYBR Green Master Mix (Roche 04887352001). HPRT or ATP5O endogenous control is used for internal normalization and results are expressed as fold change over a reference sample.
-
bioRxiv - Genomics 2019Quote: ... The library was quantified using a real-time qPCR assay (Lightcycler 480 Roche) with the universal Illumina adapter sequences IS7 and IS8 as targets ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time qPCR reactions were completed in the LightCycler® 480 instrument (Roche) using the SybrGreen master mix (Roche ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: Real-time rates of HUVECs migration were detected using the RTCA system (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time qPCR was performed using KAPA SYBR FAST mix (Kapa Biosystems, #KK4660) with a StepOne real-time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... by quantitative RT-PCR (qPCR) in Roche Light Cycler 480 (Roche). Primers and probes used for 229E ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR was performed with DNA Green reagents (Roche 06402712001) on a LightCycler® 96 system (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... RT-PCR was analyzed using a LightCycler 96 Instrument (Roche Diagnostics) with thermal cycling conditions as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR was performed using a LightCycler 480 II (Roche) and LightCycler DNA Master SYBR Green I detection (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... The RT-PCR reaction was performed on LightCycler 96 (Roche, Germany). The comparative CT method was used for analysis.
-
bioRxiv - Molecular Biology 2022Quote: ... MAD2L1 was detected by RT-qPCR analysis using the SYBR Green detection system (Roche Applied Science) and normalized to the level of the GAPDH mRNA expression and using the 2-ΔΔCT cycle.
-
bioRxiv - Genomics 2022Quote: ... The amplification of 16S rRNA genes was conducted using the KAPA2G™ Robust HotStart ReadyMix PCR Kit (Kapa Biosystems, Wilmington, MA, USA) in a total volume of 25□μl ...
-
bioRxiv - Physiology 2024Quote: ... 20 ng cDNA was used for real-time qPCR reactions with KAPA SYBR FAST qPCR Kit (Catalog no. KK4618, Roche, Basel, Switzerland) using a CFX Opus Real-Time PCR System (Bio-Rad Laboratories) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probe labelling and DNA hybridization were performed following the protocol provided with the PCR-DIG DNA-labelling and chemiluminescent detection kit (Roche).
-
bioRxiv - Microbiology 2023Quote: ... we performed the qPCR with KOD SYBR® qPCR Mix (Toyobo Co., Ltd., Osaka, JP) using Roche LightCycler® 96 real-time PCR instrument (Roche Applied Science, Penzberg, DE). The qPCR assay was conducted over 45 cycles ...
-
bioRxiv - Biochemistry 2023Quote: ... was used for cDNA synthesis and RT-qPCR was performed using KAPA SYBR FAST qRT PCR kit (KK4602, KAPA Biosystems). Taf10 was used as a control for normalisation and the fold change in mRNA levels were calculated by 2^-ddct method.
-
bioRxiv - Microbiology 2024Quote: ... and 1 μL of the reverse transcrip-tion mix from the Titan One Tube RT-PCR System kit (Roche, Switzerland) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR (qRT-PCR) was permorfed in triplicates using FastStart universal SYBR Green master Mix (Roche). Melting curves were analyzed (SYBR green ...
-
bioRxiv - Developmental Biology 2019Quote: ... Quantitative RT-PCR (Q-PCR) was performed using a LightCycler 480 II (Roche Life Science, Penzberg, Germany) and LightCycler DNA Master SYBR Green I detection (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative RT-PCR (qRT-PCR) reactions were performed as described using the Universal Probe Library system (Roche). Actin and tubulin predeveloped TaqMan assays (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... DNA detection was performed using DIG High Prime DNA Labeling and Detection starter kit (Roche). The glmS sequence amplified from pL6-HA-glmS using 5’-GATTATGCCTAATCTTGTTCTT-3’ and 5’-TAGCATTTTTCTTCCTCCTAAGAT-3’ was Dig labeled and used as a probe.
-
bioRxiv - Cancer Biology 2019Quote: ... Secondary detection was performed using UltraMap DAB anti-Ms HRP detection kit (Roche #760-152) for 16 minutes and slides counterstained with hematoxylin (Roche #760-2021 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DAB staining was detected using the UltraView Universal DAB Detection Kit or the OptiView DAB IHC Detection Kit (all from Roche). The following antibodies were used ...
-
bioRxiv - Neuroscience 2019Quote: Cells were lysed using Real-Time ready cell lysis buffer (Roche Life Science, 7248431001) with 1:80 diluted RNAse inhibitor (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... with RiboMap fixation and BlueMap detection kits (Roche). The amount of probe used (100-300 ng ...