Labshake search
Citations for Roche :
851 - 900 of 1169 citations for 192 IgG Mouse Monoclonal Cy3 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: ... the sequence was labeled with digoxigenin using the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics Deutschland GmbH, Germany). After dewaxing in water ...
-
bioRxiv - Plant Biology 2021Quote: ... Digoxigenin-11-dUTP (DIG) labeled DNA probes were generated using via PCR labelling using PCR DIG Probe Synthesis kit (Roche, catalogue no. 11636090910). 10 ng of purified plasmid DNA containing full length GFP DNA was used as PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG ...
-
Dissemination of linezolid-resistance through sex pheromone plasmid transfer in Enterococcs faecalisbioRxiv - Microbiology 2019Quote: ... blots were hybridized with digoxigenin (DIG)-labeled optrA-specific probe using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche Applied Sciences, Germany) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2022Quote: ... 1µg of DNA was labeled with digoxigenin (for chromosome III) or biotin (for chromosome V) by nick-translation according to manufacturer instructions (Roche, 11745816910 and 11745824910).
-
bioRxiv - Physiology 2020Quote: ... and immunodetection of the DIG-labeled hybrids was performed with a peroxidase-conjugated anti-DIG antibody (1:2000; raised in sheep; Roche Diagnostics, Mannheim, GER). The fluorescence signal was developed with tyramide signal amplification (TSA ...
-
bioRxiv - Genetics 2022Quote: ... Sense and antisense digoxigenin (DIG)-labeled probes were synthesized from the purified PCR product using DIG RNA Labeling Kit (Roche, cat. no.11175025910). All primer sequences were listed in Supplementary Information (Supplementary Table 3).
-
bioRxiv - Plant Biology 2022Quote: ... The PCR products were purified and used to in vitro synthesize digoxigenin-labeled sense and antisense probes using T7 RNA polymerases (Roche Diagnostics, Mannheim, Germany). ZmSOS1 sense probe was used as the negative control.
-
bioRxiv - Developmental Biology 2022Quote: ... Digoxygenin-labeled sense and antisense probes were synthesized from the linearized plasmids using the DIG RNA Labeling Kit (SP6/T7) (Roche/MilliporeSigma, Burlington, MA). Whole-mount ISH was performed as previously described (Yan et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... probe was amplified by PCR as described previously (Cox et al., 1993) and labeled using the biotin-nick translation mix (Roche Applied Science, # 11745824910), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each labeled probe was sequentially detected by incubation with a peroxidase-conjugated antibody against digoxigenin and peroxidase-conjugated anti-fluorescein (Roche, Indianapolis, IN, USA) followed by incubation with TSA-Alexa Fluor 555 and TSA-Alexa Fluor 488 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids wash and immunological detection of the DIG-labeled probes were performed using the DIG Wash and Block Buffer Set (Roche, Cat No. 11585762001) according to the manufacturer’s protocols ...
-
bioRxiv - Physiology 2024Quote: ... were PCR-amplified and transcribed in vitro to generate digoxigenin (DIG)-labeled cRNA probes using T7 RNA polymerase and DIG RNA Labeling Mix (Roche Diagnostics, Basel, Switzerland).
-
bioRxiv - Neuroscience 2020Quote: ... Thee injections of either an anti-GluA2 antibody (clone 15F1, gift from E. Gouaux) or a monoclonal anti-GFP IgG1-K (Roche, 11814460001) were targeted to the L2/3 of S1 (−0.1 to 0.3 mm dorsoventral) ...
-
bioRxiv - Plant Biology 2021Quote: ... 150mM NaCl] supplemented with 1% Tween® 20 for 30 min before probing the membrane with either rat monoclonal anti-HA antibody (3F10, Roche) or mouse monoclonal ANTI-FLAG® antibody conjugated to HRP (M2 ...
-
bioRxiv - Plant Biology 2020Quote: ... transferred to a PVDF membrane and immunoblotted with rat monoclonal anti-HA (High Affinity, clone 3F10, Roche, www.roche.com; 1:2000 dilution) and hybridized with peroxidase conjugated goat anti-rat (Polyclonal ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% bovine serum albumin (BSA)/TBS-T ...
-
bioRxiv - Cancer Biology 2023Quote: ... unconcentrated cell culture supernatants were incubated with a rabbit monoclonal anti-glycodelin antibody (clone 12C9, kindly provided by ROCHE, Penzberg, Germany) for 1 h at room temperature prior to incubation with immune cells ...
-
bioRxiv - Cell Biology 2022Quote: ... cell pellets were lysed in IgG Buffer supplemented with cOmplete™ EDTA-free protease inhibitor cocktail (Roche) and 0.2 mM Mg-ATP ...
-
bioRxiv - Microbiology 2022Quote: ... secondary antibody from Vector Laboratories ImPress VR anti-rabbit IgG polymer (# MP-6401) and visualized using the ChromoMap DAB kit from Roche Tissue Diagnostics (#760-159) ...
-
bioRxiv - Microbiology 2022Quote: ... secondary antibody from Vector Laboratories ImPress VR anti-rabbit IgG polymer (# MP-6401) and visualized using the ChromoMap DAB kit from Roche Tissue Diagnostics (#760-159).
-
bioRxiv - Cell Biology 2023Quote: ... referred as IgG) were incubated for 10 minutes at room temperature with or without protease inhibitors (Roche, cOmplete™ ...
-
bioRxiv - Developmental Biology 2020Quote: Digoxigenin (DIG)-labeled and Fluorescein (Flu)-labeled in-situ probes were synthesized using in vitro transcription with Flu/DIG RNA Labeling kits respectively (Roche,Cat#11175025910, Cat#11685619910). RNA in-situ hybridization was conducted according to the published protocol 85 ...
-
bioRxiv - Biophysics 2021Quote: ... the end of the DNA far from the promoter was labeled with beads (0.32 μm diameter, streptavidin-coated polystyrene beads (Roche Life Science, Indianapolis, IN, USA)) by flowing in the microchamber 0.03 mg/mL beads resuspended in TXB and letting them incubate for 10 min ...
-
bioRxiv - Microbiology 2021Quote: DNA protein interaction was studied with purified H-NS and DIG labeled PCR amplified PctxAB fragments by using the DIG gel shift kit (2nd Gen, Roche Aplied Science, Mannheim, Germany) as previously described (10) ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-GFP antibody (1:500, Roche, RRID:AB_390913) diluted in TNB was added to each slide under a bridged coverslip and incubated at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... then blotted with mouse anti-GFP antibody (Roche 11814460001) and anti-mouse-HRP secondary (Cell Signaling 7076) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-GFP (7.1+13.1, Roche, 11814460001; 1:1000), rabbit anti-Caveolin (BD Biosciences 610059 ...
-
bioRxiv - Neuroscience 2019Quote: ... using the KAPA Mouse Genotyping Standard Kit (KAPA Biosystems). The following primers were used for PCR ...
-
bioRxiv - Biochemistry 2019Quote: ... mouse-anti-GFP (1:1000) (Roche Cat# 11814460001, RRID:AB_390913), and rabbit-anti-Hxk1 (1:3000 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Sigma-Aldrich #11814460001-Roche; 1:5000), rabbit anti-GGA1 (Bethyl Laboratories #A305-368A ...
-
bioRxiv - Biochemistry 2021Quote: ... 1:5000 Mouse anti-HA(12CA5) (Roche, Ref#11583816001), 1:50,000 Rabbit anti-RPN10 (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-GFP (mouse polyclonal, Roche, 11867423001, 1:5000). After washing three times with TBST buffer ...
-
bioRxiv - Immunology 2021Quote: ... mouse α-GFP (clones 7.1 and 13.1, Roche, Switzerland) and rabbit α□HA (polyclonal ...
-
bioRxiv - Neuroscience 2020Quote: ... We used KAPA Mouse genotyping kits (KAPA Biosystems, USA) to determine genotypes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and mouse anti-GFP (clones 7.1 and 13.1, Roche) at a dilution of 1:3000 for blots exposed to film ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were probed with mouse anti-GFP (Roche, 11814460001), rabbit anti-Cdc2 (CDK1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Blots were developed with GFP mouse antibody from Roche Applied Science (Indianapolis ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP (Roche, 11814460001, 1/10.000 for WB), goat anti-CTSB (R&D Systems ...
-
bioRxiv - Cell Biology 2019Quote: ... primary antibodies mouse anti-GFP (Roche 11814460001, 1:500) and rabbit anti-BiP MRA-1246 (BEI resources (1:100 ...
-
bioRxiv - Genetics 2020Quote: ... Primary antibodies were anti-HA (12CA5) mouse (Roche, 11583816001) and anti-Smt3 (y-84 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-GFP clones 7.1 and13.1 (Sigma Roche: 118144600010), 1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or anti-mouse horseradish peroxidase (HRP) (760–4313, Roche) secondary antibodies and the Discovery ChromoMap DAB kit reagents (760–159 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-α2δ-1 Abs (polyclonal, Roche, Cat # C5105) at 1:1000 or with mouse anti-GAPDH (1:25;000 ...
-
bioRxiv - Neuroscience 2022Quote: ... using the KAPA Mouse Genotyping Standard Kit (KAPA Biosystems). The following primers were used for PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-GFP antibody (1:200, Roche, # 11814460001, Germany), TRITC-conjugated goat anti-rat antibody (1:200 ...
-
bioRxiv - Biochemistry 2022Quote: ... GFP was detected with mouse anti-GFP antibodies (Roche), GAPDH was detected with rabbit anti-GAPHD (Genetex) ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-GFP antibodies (1:500; 11814460001, Roche Diagnostics), anti-Nav1.1 antibodies (1:10,000 ...
-
bioRxiv - Genetics 2023Quote: ... KAPA® HotStart mouse genotyping kit (KK7351, Roche, CH) was used to extract genomic DNA and perform the PCR reaction following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-GFP (Roche, 11814460001; 1:10,000 for WB), mouse anti-α-tubulin (Cell Signaling Technology ...