Labshake search
Citations for Roche :
8851 - 8900 of 9048 citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Final cDNA libraries were checked for quality by TapeStation and qPCR (Kapa’s library quantification kit for Illumina Sequencing platforms, catalogue# KK4835, Kapa Biosystems, Wilmington MA). Samples were clustered and sequenced using NovaSeq S2 reagents (NovaSeq S2 Run ...
-
bioRxiv - Evolutionary Biology 2024Quote: A PCR free Illumina library (based on the same HMW extraction) was prepared using the Kapa Hyper Prep Kit (Roche, Basel, Switzerland), following manufacturer instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA was isolated from tail clips taken from neonatal mice during sacrifice using the Kapa Express Extract Kit (Kapa Biosystems, Cat. #KK7100) with one minor modification – sample lysis was assisted via physical homogenization using a 1.5 mL tube plastic pestle ...
-
bioRxiv - Genomics 2024Quote: ... Both DNA samples were also converted into Illumina sequencing libraries with the KAPA HyperPrep library construction kit (Roche Sequencing Solutions, Indianapolis, IN) and paired-end sequenced for 150 cycles on a NovaSeq6000 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... the RNA-seq directional libraries were generated for 1 μg rRNA-depleted RNA using the KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, KK8421). The rRNA-depleted RNA was fragmented ...
-
bioRxiv - Neuroscience 2024Quote: ... Accurate quantification of the final libraries for sequencing applications was determined using the qPCR-based KAPA Biosystems Library Quantification kit (Kapa Biosystems, Inc.). Each library was diluted to a final concentration of 1.4 nM and pooled equimolar prior to clustering ...
-
bioRxiv - Neuroscience 2024Quote: ... The concentration of each library was accurately determined through qPCR utilizing the KAPA library Quantification Kit according to the manufacturer’s protocol (KAPA Biosystems/Roche cat# KK4824) to produce cluster counts appropriate for the Illumina NovaSeq6000 instrument ...
-
bioRxiv - Plant Biology 2024Quote: ... The relative expression of genes in leaves was determined by reverse transcription quantitative PCR performed on an Applied Biosystems StepOne Real-Time PCR System with KAPA SYBR® FAST qPCR Master Mix (2X) Kit (Kapa Biosystems) according to the protocol of the manufacturer ...
-
bioRxiv - Plant Biology 2020Quote: ... and identified by morphological features.41 Polymerase chain reaction (PCR) products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and sequenced in both directions by Macrogen Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for library quantitation (Kapa Biosystems, Woburn, MA) both immediately prior to and after library construction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNAseq libraries were prepared in a single batch by the Bauer Core at Harvard using the KAPA mRNA HyperPrep Kit (Roche, Palo Alto, CA) with 300-500 nanograms of input RNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Library concentrations were determined by quantitative polymerase chain reaction (qPCR) using the KAPA SYBR FAST ABI Prism qPCR Kit (Kapa Biosystems, Wilmington, MA) and the StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... cDNA libraries were prepared using 500 ng of large RNA as input for the KAPA mRNA HyperPrep Kit (Kapa Biosystems; Wilmington, MA, USA) combined with the KAPA Unique Dual-Indexed Adapter Kit (Kapa Biosystems ...
-
bioRxiv - Pathology 2020Quote: ... the sequence was labeled with digoxigenin using the DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Diagnostics Deutschland GmbH, Germany). After dewaxing in water ...
-
bioRxiv - Physiology 2019Quote: ... PCR was carried out with KAPA SYBR® FAST Universal 2X qPCR Master Mix (Cat# KK4601) / LightCycler 480 SYBR Green I Master kit (Roche Cat# 14712220) in Vapo.Protect Eppendorf LC-480 and LC-96 from Roche system using primer pairs mentioned in Supplementary Table A.
-
bioRxiv - Neuroscience 2021Quote: 100ng of total RNA from each sample was used to prepare total RNA libraries using the KAPA Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems, Massachusetts, USA). Fragmentation prior to first strand cDNA synthesis was carried out using incubation conditions recommended by the manufacturer ...
-
Tracing production instability in a clonally-derived CHO cell line using single cell transcriptomicsbioRxiv - Cell Biology 2021Quote: ... no AS-MB-006) and RNA libraries were prepared using the KAPA Stranded RNA-seq library preparation kit (Kapa Biosystems, cat. no KK8401) according to manufacturer’s specifications ...
-
bioRxiv - Bioengineering 2021Quote: ... the quantitative real-time PCR (qRT-PCR) reactions were carried out using the KAPA SYBR FAST qPCR kit from Kapa Biosystems (MA, USA) with sfGFP-specific primer sets (Supplementary Table 4) ...
-
bioRxiv - Plant Biology 2021Quote: ... Digoxigenin-11-dUTP (DIG) labeled DNA probes were generated using via PCR labelling using PCR DIG Probe Synthesis kit (Roche, catalogue no. 11636090910). 10 ng of purified plasmid DNA containing full length GFP DNA was used as PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG ...
-
bioRxiv - Microbiology 2020Quote: ... 1μg of total RNA was reverse-transcribed to complementary DNA (cDNA) using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Indianapolis, IN, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Quantification of mcherry and gyrB (single gene copy on the plasmid and on the chromosomal DNA respectively) copy number was made from 25 pg of DNA using the LightCycler® FastStart DNA Master HybProbe kit (Roche, Bâle, Switzerland) following manufacturer’s instructions with appropriate oligonucleotides and Taqman probes (Table S1) ...
-
bioRxiv - Microbiology 2021Quote: ... The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant Kit (Kapa Biosystems Cat#KK4824).
-
bioRxiv - Microbiology 2021Quote: ... to check for size and quantified by qPCR using the Kapa Library Quantification Illumina/ABI Prism Kit protocol (KAPA Biosystems, Wilmington, MA, USA). Equimolar quantities of each library were then pooled and sequenced on the Illumina NovaSeq 6000 instrument with a SP flowcell (2 x 250 bp ...
-
bioRxiv - Microbiology 2020Quote: ... the sections were incubated with a primary antibody for 32 min at room temperature and then incubated with the reagent from an iVIEW DAB detection kit (Roche Diagnostics, Meylan, France). The sections were counterstained with hematoxylin and post-counterstained with bluing reagent ...
-
Dissemination of linezolid-resistance through sex pheromone plasmid transfer in Enterococcs faecalisbioRxiv - Microbiology 2019Quote: ... blots were hybridized with digoxigenin (DIG)-labeled optrA-specific probe using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche Applied Sciences, Germany) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... Barcode-indexed sequencing libraries were generated from reverse-crosslinked ChIP-DNA samples using a Kapa Hyper DNA Library Preparation Kit (Kapa Biosystems-Roche, Basel, Switzerland) and NextFlex UDI adapters (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... The sample DNA underwent end-repair and A-tailing with conditions of 20C for 30 minutes and 65C for 30 minutes (Roche KAPA HyperPrep kit). We ligated native barcodes using 5ul of each barcoded adapter (EXP-NBD196 ...
-
bioRxiv - Microbiology 2022Quote: ... tissues were processed using the Discovery Ultra automated stainer (Ventana Medical Systems) with a ChromoMap DAB kit (Roche Tissue Diagnostics cat#760-159). Specific immunoreactivity was detected using the GenScript U864YFA140-4/CB2093 NP-1 SARS-CoV-2-specific antiserum at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... The DNA molar concentration of the library was quantified with the KAPA Library Quantification Kit Illumina® Platform (KAPA Biosystems, Woburn, MA, USA). Libraries were sequenced using an Illumina HiSeq® X Ten System with paired-end reads by Beijing Yuanyi Biotechnology Co. ...
-
bioRxiv - Immunology 2022Quote: ... Library for RNA-Seq was prepared according to KAPA Stranded mRNA-Seq poly(A) selected kit with 201-300bp insert size (KAPA Biosystems, Wilmington, MA) using 250 ng total RNAs as input ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were prepared by the Van Andel Genomics Core from 500 ng of total RNA using the KAPA RNA HyperPrep Kit with RiboseErase (v2.17) (Kapa Biosystems, Wilmington, MA USA). RNA was sheared to 300-400 bp ...
-
bioRxiv - Cancer Biology 2022Quote: A total amount of 1 μg total RNA per sample was used for sequencing libraries generation by using KAPA mRNA HyperPrep Kit (KAPA Biosystems, Roche, Basel, Switzerland) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative real time PCRs (qPCRs) were performed in a total volume of 10 μl with Kapa SYBR Fast qPCR kit (KAPA Biosystems, Wilmington, MA) on an ABI 7500 fast machine operated with ABI 7500 software (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2ul of DNA (20 ng of DNA) was added at 10ul of a reaction buffer (Light Cycler Fast Start DNA Master SYBR Green Kit, Roche Diagnostics, Basilea, SWI) and 1% SDS ...
-
bioRxiv - Genomics 2020Quote: ... resuspended in 10 μl of 10 mM tris-HCl (pH = 8.5) and quantified using qPCR with the KAPA Library Quantification Kit (Roche Diagnostics, Diegem, Belgium, KK4854) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems, Woburn, MA) prior to cluster generation.
-
bioRxiv - Paleontology 2022Quote: DNA library construction for whole-genome sequencing was performed using the KAPA Hyper Prep Kits for Illumina® NGS platforms (KAPA Biosystems, KK8504). Adapters and 8bp index oligos purchased from IDT® (Integrated DNA Technologies ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions were performed using 50 ng of metagenomic DNA per sample using the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, USA). The individual PCR reactions were performed in 20 µL final volume and containing 4 µL of 5X Kapa HiFi Buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... The cDNA was diluted 20-fold and used for qRT-PCR employing a LightCycler® 480 SYBR Green 1 Master PCR labelling kit (Roche Applied Sciences) and RotorGene 3000 Real time PCR machine (Corbett Research ...
-
bioRxiv - Immunology 2020Quote: ... using the Ovation RNA-Seq System (NuGEN Technologies Inc., San Carlos, CA) followed by KAPA Hyper library preparation kits (KAPA Biosystems, Wilmington, MA) on an Illumina NextSeq 500 sequencing platform with 76-bp ...
-
bioRxiv - Cancer Biology 2019Quote: Four RNA-seq libraries (from CER217, CER218, CER220, and CER221 strains) were prepared with the KAPA Stranded mRNA-Seq Illumina® Platforms Kit (Roche-Kapa Biosystems) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2019Quote: ... Reverse transcription of 1 µg RNA into cDNA was done using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Cancer Biology 2019Quote: ... Immunostaining was carried out using the BenchMark XT (Ventana Medical Systems, Illkirch Graffenstaden, France) with the OmniMap kit (a “biotin-free” system using multimer technology, Roche, Boulogne Billancourt, France) and a Tris borate EDTA pH8 buffer for antigen retrieval ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 8μm thick tissues were subjected to TUNEL staining according to the manufacturer’s instructions for an In-Situ Cell Death Detection Kit (Cat. 11684817910, Roche Diagnostics, Indianapolis, IN, USA). Sections were then visualized with a fluorescence microscope (Nikon ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resulting cDNAs were qPCR amplified using the Roche LightCycler 480 SYBR Green I Master kit and the LightCycler® 480 instrument (Roche Applied Science). Cycling conditions were set at 95°C for 30 s ...
-
bioRxiv - Microbiology 2021Quote: ... The dsRNA-seq library was prepared according to KAPA KK8540 RNA HyperPrep kit with 201-300 bp insert size (KAPA Biosystems, Wilmington, MA) using 25-50 ng of total dsRNA as input ...
-
bioRxiv - Zoology 2019Quote: ... PCR products were visualized on a 1.5% agarose gel and cleaned using the HiPure PCR product Cleanup kit (Roche Life Sciences, Indianapolis, IN) and sent for sequencing at Macrogen USA (Rockville ...
-
bioRxiv - Molecular Biology 2019Quote: ... and an equimolecular pool of libraries was prepared and titrated by qRT-PCR using the “Kapa-SYBR FAST qPCR kit forLightCycler480” (Kapa BioSystems, Fritz Hoffmann-La Roche, Basilea, Switzerland) and a reference standard for quantification (Genomics Unit ...
-
bioRxiv - Genomics 2021Quote: ... Paired-end multiplex libraries were prepared according to the instructions of the manufacturer with the KAPA PE Library Preparation kit (Kapa Biosystems, Wilmington, MA). Libraries were loaded to Illumina flow-cells for cluster generation prior to producing 100 bp paired-end reads on a HiSeq2000 instrument following the Illumina protocol ...