Labshake search
Citations for Roche :
8151 - 8200 of 8217 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... resuspended in French Press buffer (40 mM HEPES, 100 mM KCl, 20 mM imidazole, 2 mM PMSF, EDTA-free cOmplete protease inhibitor [Roche], pH 7.5) for 1 hour followed by homogenization using tight douncer ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lysates were prepared by scraping cells using 1X lysis buffer (10X recipe-50 mM Tris pH 7.5, Triton 20%, NP40 10%, 2 M NaCl, mixed with cOmplete protease inhibitor tablet - Roche, Product number 11873580001). Cell lysates were rotated on a wheel at 4°C for 15 min and centrifuged for 10 min at 13,000 rpm 4°C to pellet the cell debris ...
-
bioRxiv - Immunology 2022Quote: Anti-SARS-CoV-2 (N protein) IgM/IgG levels in the serum were measured using an Elecsys Anti-SARS-CoV-2 with cobas8000 (Roche Diagnostics KK) at the Department of Clinical Laboratory ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in lysis buffer (25 mM HEPES pH 7.5, 400 mM NaCl, 10 mM 2-mercaptoethanol, 0.1% Triton X-100 supplemented with lysozyme and Roche cOmplete protease inhibitor tablet), lysed by sonication (50% duty cycle ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Dynabeads™ were washed once with 2 ml of PBS and coated with 15 μg of mouse monoclonal anti-GFP antibody (Roche Applied Science). The beads were finally washed three times with 2 ml of lysis buffer and added to the whole cell extract for a 2 h incubation with gentle rotation ...
-
bioRxiv - Pathology 2021Quote: CCDs were dissected under stereomicroscopic observation either from fresh kidney slices (microperfusion) or after liberase treatment (Blendzyme 2, Roche Diagnostics, Meylan, France) (immunoblotting ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl, 2 mM MgCl2, 0.3 % Triton X-100, 0.25 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by sonication using Diagenode Bioruptor for 10 min (30 sec ON ...
-
bioRxiv - Cell Biology 2021Quote: A reference sample was generated by lysing TK6 cells in DPBS with 2% SDS and cOMPLETE protease inhibitors without EDTA (Roche, 1x concentration) at 70 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... the probe for RNA FISH was prepared with 2 µg of BAC RP183A17 using Nick translation kit (10976776001) purchased from Roche (Basel, Switzerland). Salmon sperm DNA and cot1 DNA were added to the probe to mask the repetitive sequence ...
-
bioRxiv - Microbiology 2020Quote: ... was cut into small pieces of approximately 2 mm3 in a petri dish using a sterile scalpel and transferred into a 2 ml MagNA Lyser bead tube (Roche, United Kingdom). Following this ...
-
bioRxiv - Genomics 2020Quote: ... The fixed tissue was washed twice for 2 minutes with icecold PBS plus 1x cOmplete™ mini Proteinase Inhibitor (PI) Cocktail (Roche, 11846145001). The tissue was minced by the Dounce Tissue Grinder (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue was transferred to a 50 mL conical tube and resuspended in DPBS/BSA containing collagenase B (2-4 mg/mL) (Roche, Mannheim, Germany) and DNase I (2,000 U/mL ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 1st PCR was performed in a 12-μL total volume of reaction mixture containing 6.0 μL of 2 × KAPA HiFi HotStart ReadyMix (KAPA Biosystems, MA, USA), 0.72 μL of forward and reverse primer (10 μM) ...
-
bioRxiv - Immunology 2022Quote: ... colon tissue was homogenised in 350 µl of lysis buffer (40 ml of PBS, 10%FCS, 2 Complete Protease Cocktail Inhibitor Tablets (Roche, Mannheim, Germany). Each sample was subject to 3 rounds of homogenisation using a MagnaLyser (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... were homogenized in 2 mL Precellys tube (Bertin Instruments) containing ceramic beads and 600 μL MagNaPure LC RNA Isolation Tissue buffer (Roche Life Science). The homogenate (400 μL ...
-
Gut microbial disruption in critically ill patients with COVID-19 associated pulmonary aspergillosisbioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 infection was confirmed by quantitative reverse transcription PCR (TaqMan™-PCR performed on Roche cobas® 6800, Basel, Switzerland), performed on nasopharyngeal swabs or tracheal fluid ...
-
bioRxiv - Molecular Biology 2024Quote: ... while remaining cells were harvested in 500 µL lysis buffer (50 mM Tris pH6.8, 2% SDS, 1x protease inhibitor (Roche Complete EDTA-free)) snap-frozen and stored at -70 °C until further processing.
-
bioRxiv - Cell Biology 2024Quote: ... Each reaction was then added to Strep-Tactin®XT 4Flow® high capacity resin (IBA # 2-5030-010) pre-equilibrated with XB buffer supplemented with cOmplete™ EDTA-free Protease Inhibitor tablets (Roche #11873580001) and/or PhosSTOP™ Phosphatase Inhibitor Tablets (Roche # 04906845001) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% 2-mercaptoethanol and 0.02% bromophenol blue) containing protease inhibitors (0469315900, cOmplete® Mini EDTA-free Protease Inhibitor Cocktail Tablets, Roche, Mannheim, Germany). The samples were separated by SDS-PAGE using 7.5% or 10% acrylamide gels at 100 V for about 2 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... coli CFPS of GRFT was conducted at a 25 μL scale in 2 ml Eppendorf tubes using the PANOx-SP system utilizing a phosphoenolpyruvate (Roche, Indianapolis, IN), amino acids (Sigma Aldrich ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... minced finely and digested in pre-warmed PBS (with calcium and magnesium) with 2 mg/ml of collagenase A (Roche, Basel, Switzerland) for 1h on a rotating wheel at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: Whole brains or dentate gyrus regions (isolated from the brain slices) were lysed in 2% sodium dodecyl sulfonate (SDS) with protease and phosphatase inhibitors (Roche Applied Sciences) and manually homogenized ...
-
bioRxiv - Physiology 2024Quote: ... fixed with 4% PFA for 15 min and stained with 4′,6-diamidino-2-phenylindole (DAPI) (0.1 µg/mL; Roche, cat no. 10236276001) for 10 min at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR reactions were carried out on 2 µL of cDNA using 7 µL of FastStart SYBR Green Master Mix (Roche, Basel, Switzerland), 2 µL of ddH2O (Roche ...
-
bioRxiv - Immunology 2024Quote: ... The level of indicated genes were determined by qPCR with 2×PolarSignal™ SYBR Green mix Taq (cat. #MKG900-10, MIKX) using LightCycler® 480 System (Roche). The primers used in qPCR were listed in Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... 42 ℃ for 5 min and 95 ℃ for 10 s followed by 40 cycles of 95℃ for 5 s and 60 ℃ for 20 s on an LightCycler® 480 Instrument (Roche Diagnostics Ltd, Rotkreuz, Switzerland). The absolute quantification of SARS-CoV-2 RNA levels was performed by comparison to a standard curve and shown as SARS-CoV-2 RNA copies per mouse ...
-
bioRxiv - Immunology 2024Quote: ... and 0.5% Triton X-100) with 1x protease and phosphatase inhibitors (c0mplete™ Protease Inhibitor Cocktail, Roche, product number 04693159001; PhosSTOP™, Roche, product number 04906837001). The resulting lysate was transferred to a labeled 1.5mL tube and placed on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:50 in dH2O and mixed with an equal volume of target-specific primers and Roche 2×SYBR master mix (Roche, Cat No.04707516001). Plates were centrifuged at 1000 rpm for 1 min and stored at 4°C in the dark until ready for use ...
-
bioRxiv - Developmental Biology 2022Quote: ... but with several differences from incubation with the anti-DIG antibody on: Incubation with blocking Buffer (2% Blocking Reagent from ROCHE in MABTween 1x) for 1 h ...
-
bioRxiv - Genomics 2020Quote: ... SeqCap library preparation was performed using custom Nimblegen SeqCap probes (described above in §2.1) according to the NimbleGen SeqCap EZ HyperCap Workflow User’s Guide Ver 2 (Roche Sequencing Solutions, Inc., CA USA). Following capture ...
-
bioRxiv - Microbiology 2020Quote: Deidentified remnant patient samples that underwent routine clinical testing with the cobas SARS-CoV-2 assay on the 6800 platform (Roche Diagnostics, Indianapolis, IN) were used to evaluate the Xpert and ID Now assays ...
-
bioRxiv - Microbiology 2021Quote: ... 1% Triton X-100, 150 mM NaCl, 10% glycerol, and 2 mM EDTA plus one Complete EDTA-free protease inhibitor tablet [Roche] per 50 ml) for 1 hr ...
-
bioRxiv - Cell Biology 2022Quote: ... triton X-100 in HBSS for 10 min and incubated with blocking solution containing 2% (w/v) bovine serum albumin fraction V (Roche, Woerden, The Netherlands) and 0.1% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
bioRxiv - Cell Biology 2021Quote: ... using 2 μL of the diluted cDNAs and the KAPA SYBR ® FAST qPCR Kit Optimized for Light Cycler ® 480 (KAPA biosystems). Differences between samples and controls were calculated based on the 2−ΔCT method ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 12.5 ng of purified DNA from each sample was used as a template for PCR amplification in 25 μl reaction mixture by using 2 × KAPA HiFi Hot Start Ready Mix (Kapa Biosystems, MA, USA). For PCR amplification ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK293 cells were transiently transfected with β-arrestin 2-Renilla luciferase 8 (Rluc8) and human C5aR2-Venus constructs using XTG9 (Roche, Sydney, Australia) for 24 h ...
-
bioRxiv - Physiology 2020Quote: ... finely cut with scissors and incubated in digestion medium (PBS with 2% BSA, 1M CaCl2, 94U/ml dispase II and 100mg/ml collagenase D, Roche Life Science, France) at 37°C for 30-40min ...
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates were extracted with phosphate-buffered saline (PBS) containing 2 % Triton X-100 and protease inhibitors (Roche Complete, Roche Diagnostics, Mannheim, Germany). Protein concentrations were determined by BCA-assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: Capture-based libraries were prepared following the KAPA RNA HyperCap workflow with specific enrichment probes for SARS-CoV-2 (Roche Diagnostics, Mannheim, Germany). Each individual library was created using 10ul of extracted RNA input and following the protocol established by the kit’s manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 50-200 mL of room temperature Ribosome Lysis Buffer supplemented with 2 EDTA-free protease inhibitor tablets (Roche, Catalog Number 04693132001), Turbo DNAse (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 100-200 mL of room temperature eIF3 Lysis Buffer supplemented with 2 ethylenediamine tetraacetic acid (EDTA)-free protease inhibitor tablets (Roche, Catalog Number 04693132001), 20 mM imidazole ...
-
bioRxiv - Cancer Biology 2024Quote: ... To maintain the carryover ≤ 20% with intra-day and inter-day (2 d) CV%≤ 20% acceptable for bioanalytical assays ((Clouser-Roche et al., 2008), it was necessary to perform intermediate a post-run wash injection following each standard and sample injection ...
-
bioRxiv - Microbiology 2024Quote: ... 12 ng of genomic DNA was amplified in a 25 µL reaction comprised of 2x Kapa HiFi Master Mix (Roche cat # KK2601/2), 1 µL of 10 µM V4 515F/806R primers with Illumina adapters (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGYCAGCMGCCGCGGTAA -3’ ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was discarded and the pure nuclear pellets were resuspended in boiling buffer (100mM Tris pH8.0, 2% SDS, 100μM PUGNAc, and Roche EDTA-free protease inhibitor cocktail) [59] ...
-
bioRxiv - Biophysics 2024Quote: ... Purified motor proteins were diluted to indicated concentrations in the assay buffer with 2 mM of corresponding nucleotides (ATP-Chem Imex, ADP-Sigma Aldrich, or AMPPNP-Roche Diagnostics GmbH)fr ...
-
bioRxiv - Developmental Biology 2024Quote: ... eighty nanograms of cDNA products were amplified for another five PCR cycles using KAPA HiFi HotStart Uracil 2 x ReadyMix (Kapa Biosystems, Cat. KK2602) and designed primers Biotin-ACTAG/ideoxyU/CTACACGACGCTCTTCCGATCT and ACTAG/ideoxyU/AAGCAGTGGTATCAACGCAGAG ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies to the spike protein receptor binding domain and nucleocapsid were measured by the Roche Elecsys Anti-SARS-CoV-2 S and Anti-N assay (Roche Diagnostics, Indianapolis, IN), per manufacturer’s instructions ...