Labshake search
Citations for Roche :
751 - 800 of 2228 citations for MBL 2 MBP C Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... only donors were included that had no history of COVID-19 as well as had tested negative in three serological assays (EuroImmun-Anti-SARS-CoV-2 ELISA IgG /S1/, Siemens Healthineers SARS-CoV-2 IgG /RBD/, and Roche Elecsys Ig /Nucleocapsid Pan Ig/). PBMC were selected from heparinized full blood by a standard density gradient (Pancoll Separating Solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then treated with DNase-free RNase (Roche; 5 μg.ml-1; 37°C; 30 min) and proteinase K (250 μg.ml-1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 30 min at 37°C and additionally with 1 mg/ml of collagenase solution (Roche) for 12-18 hr at 37°C with agitation ...
-
bioRxiv - Immunology 2019Quote: ... skin samples were digested for 1h at 37°C using 1 U/mL Liberase TM (Roche) and 5 µg/mL DNAse I (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: ... To increase probe permeability embryos were incubated at 21°C in 10µg/ml proteinase K (Roche) for the following durations ...
-
bioRxiv - Physiology 2019Quote: ... Then all samples were incubated with TUNEL reaction mix for 60 minutes at 37 °C (Roche). After washing ...
-
bioRxiv - Molecular Biology 2021Quote: ... embryos were washed with hybridization buffer at 55 ̊C and incubated with Western Blocking Reagent (Roche) at room temperature for one hour ...
-
bioRxiv - Cancer Biology 2021Quote: ... Chromatin was then de-crosslinked overnight at 65°C in the presence of proteinase K (Roche), purified by phenol and phenol-chloroform extractions ...
-
bioRxiv - Cell Biology 2019Quote: ... the slides were incubated for 5 h at 8°C with mouse anti-DIG antibody (Roche, Basel ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were incubated overnight at 4 °C with rat anti-HA Abs at 1:200 (Roche) and guinea-pig anti-red fluorescent protein (RFP ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated at 37°C for 30 min with 0.5 mg/ml liberase DL (Roche Basel, Switzerland) and 100 U/ml DNase (Roche Basel ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 30 minutes at 37 °C and then with ∼1.2 mg/mL Proteinase K (3115879001, Roche) overnight at 65°C ...
-
bioRxiv - Immunology 2019Quote: ... Tissue was transferred to C-tubes (Miltenyi) and digested using Liberase™ (Roche, 57.6 μg/ml) in the presence of DNase I (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: ... the sections were incubated overnight at 4°C with alkaline phosphatase–conjugated antibodies to digoxigenin (Roche) at a dilution of 1:2000 in the same solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Annealed oligonucleotides were subsequently phosphorylated for 30 minutes at 37°C using T4 polynucleotide kinase (Roche). 5 μL of 25 × diluted oligonucleotides and 50 ng of the digested and dephosphorylated vector were ligated overnight at 16°C using T4 Ligase (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... -C and -G in a pX330 vector was transfected into HAP1 cells using X-tremeGENE (Roche). Single cells were FACS sorted based on W6/32 negativity to obtain knockout clones for HLA-A ...
-
bioRxiv - Microbiology 2019Quote: ... Contaminating DNA was digested by DNase I (Roche; 1 U/µg RNA, 60 min, 37°C) in the presence of RNase inhibitor (RNaseOUT ...
-
bioRxiv - Microbiology 2019Quote: ... Microarrays were hybridized for 20 hours at 42°C with the NimbleGen Hybridization System (Roche NimbleGen). Afterwards ...
-
bioRxiv - Microbiology 2020Quote: ... Viruses were treated for 30 min at 37°C with 1,000 U of DNase I (Roche). As a control ...
-
bioRxiv - Cancer Biology 2022Quote: ... Then the samples were incubated overnight at 4 °C with proliferation marker Ki67 (790–4286, Roche). After 3 washes with PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and stored at least 1 hour at −20 °C before staining with Tdt reaction mix (Roche Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... were coated O/N at 4 °C with 50 μl of fibronectin (50 μg/ml; Roche) or VCAM-1-Fc (10 μg/ml R&D System) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 42 °C and detection was performed by chemiluminescence using anti-Digoxigenin-AP Fab fragments (Roche) and CDP-Star chemiluminescent substrate (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... embryos were washed with hybridization buffer at 55°C and incubated with Western Blocking Reagent (Roche) at room temperature for ∼2 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... DRG were incubated for 1 hour at 37 °C with 1 mg/ml dispase II (Roche) and 2 mg/ml collagenase A (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... PH 7.5)) and then incubated overnight at 4 °C in anti-DIG POD antibody (Roche, 11207733910) diluted 1:300 in blocking solution ...
-
bioRxiv - Genomics 2023Quote: ... final extension 5 min at 62 °C) using the KAPA HiFi HotStart Ready Mix (Kapa Biosystems). Amplified libraries were purified ...
-
bioRxiv - Biochemistry 2023Quote: HDX of unbound and bound c-Met (1:2.2 ratio with mAb (Roche Diagnostics GmbH, Germany)) was performed by diluting c-Met into labelling buffer (20mM Histidine ...
-
bioRxiv - Plant Biology 2023Quote: ... The membranes were probed overnight at 4°C with monoclonal anti-GFP primary antibodies (Roche, 11814460001) at 1:1,000 and then with anti-mouse peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Physiology 2024Quote: ... digested for 30 minutes at 37°C with 0.5-1 µg/ml of proteinase K (Roche), quickly rinsed with cold PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... HBE were processed for protein lysates and stored at -20°C (Complete Lysis-M Roche diagnostics). NET dosage was an average of extracellular dsDNA concentration (QuantiFluor ONE dsDNA System ...
-
bioRxiv - Microbiology 2023Quote: ... 720 μL concentrated solution was treated with 1000U/mL DNase I (37°C, 2h) (Roche, China) before viral DNA extraction ...
-
bioRxiv - Molecular Biology 2024Quote: ... The beads were washed three times in Buffer C complete including 1x complete protease inhibitors (Roche) and 0.5 mM DTT ...
-
bioRxiv - Neuroscience 2024Quote: ... Larvae were incubated overnight at 4°C in horseradish peroxidase-coupled anti-FITC antiserum (11426346910, Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues were incubated overnight at 4°C in alkaline phosphatase-coupled anti-FITC antiserum (11426338910, Roche) diluted 1:5000 in blocking buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2 supplemented with protease and phosphatase inhibitor cocktails (Roche)) for 20 minutes at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 M NaCl with Complete protease inhibitor tablet (Roche, Indianapolis, IN) and centrifuged for 30 min at 13,000 rpm 4°C to pellet cell debris ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM EDTA) supplemented with EDTA-free protease inhibitor cocktail (Roche), phosphatase inhibitor (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.1% SDS) and 2 mM EDTA + protease inhibitor cocktail (Roche) by sonicating for 5 min at medium power using a Bioruptor (Diagenode) ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were incubated in blocking solution (2% Roche Blocking Reagent (Roche)) for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000 ...