Labshake search
Citations for Roche :
751 - 800 of 3928 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.2%v sodium deoxycholate and 10mM Cacl2) supplemented with EDTA-free protease inhibitor (Roche, 11873580001) for 20min on ice ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5% (w/v) sodium deoxycholate and EDTA-free protease inhibitor cocktail (cOmplete, Roche Life Science), prior to separation using denaturing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Cell Biology 2022Quote: ... containing 1% NP-40 and 0.25% sodium deoxycholate plus a complete protease inhibitor cocktail (Roche) on ice ...
-
bioRxiv - Biochemistry 2022Quote: ... containing 150 mM sodium chloride and 1 mL of 50 x Complete Proteinase inhibitor (Roche 45582400 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% NP-40 and 0.5% sodium deoxycholate) with protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany) and kept on ice for 30 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% (w/v) sodium dodecyl sulfate) for lysis containing complete protease inhibitor cocktail (Roche). Lysates were homogenized using a handheld cell disruptor and sample concentrations were determined using a DC Lowry protein assay (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1% sodium dodecyl sulfate) with added protease and phosphatase inhibitors (Roche Applied Science, Mannheim, GER). Myofibrillar proteins were pelleted by centrifugation at 700g for 5min and the protein concentration of the sarcoplasmic fraction (supernatant ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10% Glycerol) containing 1 mM Sodium Vanadate and the protease inhibitor cocktail Complete Mini (Roche). Then ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% SDS and 0.5% sodium deoxycholate) supplemented with EDTA-free protease inhibitor (Roche Applied Science) and PhosSTOP phosphatase inhibitor (Roche Applied Science) ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5% sodium deoxycholate) supplemented with 1 tablet per 10ml buffer of the protease inhibitors (Roche) and 4U per ml buffer Turbo-DNase (Thermofisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% sodium dodecyl sulfate) supplemented with protease and phosphatase inhibitor cocktails (Roche, 04693159001 and 04906837001). For probing endogenous ITGβ5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 0.1% w/v sodium dodecyl sulfate) with cOmplete protease inhibitor cocktail (Roche, Basel, Switzerland). The EV and cell lysate protein concentrations were determined using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.1% Sodium Deoxycholate) complemented with protease inhibitor cocktail tablet (Roche, Ref 05 892 791 001), PMSF (1mM final) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% SDS) supplemented with 1 mM Sodium orthovanadate (Na3VO4) and protease inhibitors (Roche, Cat. # 11836170001). Total protein concentration was measured by Bradford protein assay (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5% w/v sodium deoxycholate) with a 1x protease inhibitor cocktail (Roche, VWR, Cat# PI88266) and 0.5% v/v SUPERase In (Life Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.1% sodium dodecyl sulfate (SDS) and 1% TritonX-100) supplemented with Protease Inhibitor (Roche, 11873580001). Extracted proteins were boiled for 10 min with 2X Laemmeli buffer (100mM Tris-HCl pH6.8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 1 mM sodium orthovanadate and Complete mini EDTA free protease inhibitor cocktail (Roche Diagnostics). Soluble proteins were separated by SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... 4 U DNase I (Roche) with the reaction buffer provided with the enzyme for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM EDTA pH 8) in presence of Complete Protease Inhibitor Cocktail (Roche) and Halt Phosphatase Inhibitor Cocktail (Pierce) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 8) containing one tablet of cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). Cells were lysed via two passages through a French pressure cell at 1,500 psi ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the remaining 21865 reads (∼8 Mb) were submitted for assembly by Newbler (Roche). Of the 6309 obtained contigs (N50 = 663 bp) ...
-
bioRxiv - Microbiology 2021Quote: ... pH 8 (buffer A) supplemented with EDTA free complete protease inhibitor tablets (Roche). The cells were lysed using a French press at 18000 psi ...
-
bioRxiv - Cell Biology 2022Quote: Conjugation of protein or nanobody was performed with an 8-fold (Laminin; Roche) or 4-fold (R2-myc-his ...
-
bioRxiv - Genetics 2023Quote: ... with 6-8 cycles of PCR amplification using KAPA-HiFi (Kapa Biosystems, KK2602). DNA library was sequenced using an Illumina NextSeq 500 75-cycle high output kit.
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reaction was stopped by the addition of 500 ng of plasmid (size > 10 kb) and 0.1 pmol of ATP-γ-S tetralithium salt (10102342001-Roche, Sigma) followed by incubation for 30 min at 30°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... followed by perfusion with Hanks’ balanced salt solution with Mg2+ and Ca2+ containing 0.1 mg/mL of Liberase (Roche Applied Science). Following the removal of the liver ...
-
bioRxiv - Physiology 2021Quote: ... Collagen was then extracted from the tissue samples using a salt extraction buffer (1 M NaCl, 25 mM EDTA, 50 mM Tris-HCl, pH 7.4) containing protease inhibitors (Roche, Basel, Switzerland). Samples were extracted overnight at 4°C with agitation ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... NimbleGen 4-plex arrays containing 4 × 72,000 arrays per slide were used (Roche, Mannheim, Germany). Construction of this chip was initially based on combining two previous genome annotations (Amselem et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg of plasmid and 4 μl of X-tremeGENE HP DNA Transfection Reagent (Roche) were used per well ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...