Labshake search
Citations for Roche :
7701 - 7750 of 8748 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Protein expression was determined by solubilizing 2–4 x 106 cells in lysis buffer (1% Triton X-100, 150 mM NaCl, 0.5 mM EDTA) plus 2X protease inhibitor cocktail (Roche Applied Science, Boulder, CO). Samples were analyzed by SDS-PAGE and Western analysis was performed using either mouse anti-FLAG antibody (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: Cell pellets were resuspended in 300 μL of buffer 1 (20 mM K-HEPES pH 7.9, 50 mM KCl, 10% glycerol and Roche EDTA-free protease inhibitors). Samples were sonicated on ice using a probe-type sonicator (4 cycles of 15 s with 15 s resting on ice ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 mM Tris-HCl pH 7.5/140 mM NaCl/1% NP-40/1% sodium deoxycholate/0.1% sodium dodecyl sulfate (SDS)) and 150 μL of Complete Mini protease inhibitor cocktail (Roche Diagnostic Systems, Laval, Canada). Harvested cells were sonicated using three 12-second bursts of a Sonic Dismembrator (model 500 ...
-
bioRxiv - Biophysics 2024Quote: ... The pellet was resuspended in 50 ml lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, Roche Complete protease inhibitor cocktail) and the lysate was boiled for 20 min ...
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and 5 mM ethylenediaminetetraacetic acid (pH 8.0)] containing protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN, USA) for 45 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... the presynaptic filament was formed by incubating 5 μl of streptavidin-coated magnetic resin (Roche Molecular Biochemicals) with 5’-biotinylated 80-mer ssDNA oligonucleotide (5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... for 5 minutes and cells were washed in cold PBS supplied with protease inhibitor cocktail (11873580001, Roche). Cells were stored as dry cell pellet at -80°C until further processed ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked in 5% skimmed milk and probed with anti-HA (Roche anti-HA-HRP 3F10), anti-Myc mouse monoclonal antibodies (Roche ...
-
bioRxiv - Immunology 2022Quote: ... 0.5% Na-deoxycholate) supplemented with 5 mM diisopropylfluorophosphate (DFP) in addition to the protease inhibitor cocktail (Roche). Cell scrapper was used to ensure optimal recovery of cell lysate ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of the enriched phage pools (50 μL reactions) and a high-fidelity phusion polymerase (Roche) were used for the PCR reaction ...
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM EDTA, 0.10% NP40, 0.5 mM sodium orthovanadate, 0.5 mM NaF, protease inhibitor cocktail from Roche) and reduced in the presence of β-mercaptoethanol by boiling at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... supplemented with Complete Mini EDTA-free Protease inhibitor tablets (46548400, Roche, ½ tablet per 5 mL lysis buffer) and phosphatase inhibitors (CA80501-130 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix consisted of 5 μL 2X LightCycler® 480 Probes Master (Roche, Cat. No. 04707494001), 1 μL MDA product ...
-
bioRxiv - Cancer Biology 2019Quote: ... PBS was aspirated and 5 ml 0.25% pre-warmed trypsin-EDTA with 10 U/µl DNaseI (Roche) was added and put into a 37°C water bath for 30 minutes with gentle inversion every 5 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... the tryptic digests were cleaved by chymotrypsin (5 ng/μl, sequencing grade, Roche, in 25 mM AB) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by resuspension in 1 volume of Buffer C (5 mM Hepes pH 7.9, 26% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1xPIC (Roche) and 0.5 mM DTT ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were incubated for 1 hour in blocking solution (Tris 0.1M pH 7.5, NaCl 150mM, Tween-20 0.1% and 5% blocking reagent Roche) and then with POD-conjugated anti-FITC antibody (11426346910 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% NP-40 and 5 mM beta-mercaptoethanol) supplemented with Complete EDTA-free Protease Inhibitor Cocktail (Roche). The suspension was flash frozen in droplets ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were resuspended in PBS buffer supplemented with 5 mM imidazole and protease inhibitors (cOmplete, Roche). Cells were lysed by sonication and incubated at 80°C in a water bath for 10 min with sporadic manual agitation ...
-
bioRxiv - Molecular Biology 2024Quote: ... MEFs were frozen in liquid nitrogen and stored at 80 °C or directly lysed with lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 0.5% NP40, 0.5% Triron-X100, 5% glycerol, 1x Roche Complete EDTA free inhibitor cocktail ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were soaked in blocking solution (5% sterile horse serum, 0.5% Roche western blocking reagent in TNTx) for two hours at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries or testis were added to 1 mL of cold lysis buffer (50 mM Tris-HCl pH 8.0, 0.2% NP-40, 150 mM NaCl, 5 mM EDTA, 0.1 mg/mL PMSF, Roche complete EDTA-free protease inhibitor tablet ...
-
bioRxiv - Microbiology 2023Quote: ... D311A 5’-ATA ATC CCA TTT GGC GAC GTC AAT G) using KAPA HiFi HotStart ReadyMix (Roche). Homozygous KI was confirmed by Sanger sequencing after amplification using primer SAM_Seq_Ex16_FW (5’-CAT GAA GGC TCT TCC TGC GTA A ...
-
bioRxiv - Cell Biology 2023Quote: ... or ELB buffer (250 mM NaCI, 5 mM EDTA, 50 mM HEPES, 0.1% Ipegal, Roche protease inhibitor) with sonication (Qsonica ...
-
bioRxiv - Genomics 2023Quote: ... Magnesium chloride was added to a final concentration of 5 mM and KAPA HiFi 2x ReadyMix (Roche) was used ...
-
bioRxiv - Biochemistry 2023Quote: ... Membranes were incubated one hour in 5% milk before adding the primary antibody (anti-HA 3F10, Roche 27573500 ...
-
bioRxiv - Neuroscience 2023Quote: ... homogenization buffer (0.32 M sucrose, 5 mM HEPES, in PBS pH=7.4, with protease inhibitor cocktail [Roche]) was added to hippocampi samples ...
-
bioRxiv - Microbiology 2023Quote: ... 50 mM Tris-HCl, pH 7.5; 5 mM EDTA; 0.5% Igepal-CA630; 1.0% Triton X-100; protease inhibitors [Roche]) and debris was removed by centrifugation ...
-
bioRxiv - Molecular Biology 2020Quote: Cryosections (10μM) of ventricular tissue were fixed in 4% paraformaldehyde and stained with In-situ Cell Death Detection kit (Roche). Sections were imaged on a laser-scanning confocal microscope (LSM 510 ...
-
bioRxiv - Genetics 2021Quote: ... Then they were incubated overnight at 4°C with primary antibodies diluted in a dilution buffer (0.5% blocking reagent (Roche), 2% fetal bovine serum ...
-
bioRxiv - Developmental Biology 2020Quote: ... the embryos were washed and equilibrated in NTMT buffer followed by coloration with 4-nitro blue tetrazolium (NBT, Roche) and 5-Bromo-4chloro-3-indolyl-phosphate ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 were purified according to the instructions of the manufacturer using the High Pure PCR Template Preparation Kit (Roche) followed by RNAse A digest and a final purification with the High Pure PCR Product Purification Kit (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... qPCR reactions were performed in 10 μl reactions containing 4 μl of LightCycler 480 SYBR Green I Master (Roche), 4 μl of PCR-grade water (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... The PBS was aspirated and 1 ml of homogenization buffer (320 mM sucrose, 4 mM HEPES NaOH, pH 7.4) supplemented with cOmplete EDTA-free protease inhibitor (Roche) and 1 mM ATP NaOH ...
-
bioRxiv - Neuroscience 2019Quote: ... the pellet was re-suspended in SDS lysis buffer (137 mM Tris-HCl pH 6.8, 4% SDS, 20% Glycerol, Proteinase inhibitor, Roche), sonicated and quantified using the Pierce BCA Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2019Quote: ... some TK rats (n=11) were orally administered 4 mg of valganciclovir (val) to reduce neurogenesis (Hoffman La-Roche; delivered in 0.5 g peanut butter + chow pellets ...
-
bioRxiv - Molecular Biology 2019Quote: Cells were collected after two cold PBS washes by scraping in 2X SDS Lysis Buffer (4% SDS, 20% Glycerol, 120mM Tris-Cl pH 6.8, 1x protease (Roche) and phosphatase inhibitors (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2019Quote: ... 4 million cells were seeded in a 10 cm cell culture dish for transfection using X-tremegene 9 (Roche) and Opti-MEM (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... cell pellets were lysed in 4% SDS/100 mM Tris HCl pH 7.4 supplemented with cOmplete protease inhibitor cocktail (Roche), and sonicated at 4 °C using a Diagenode Bioruptor ...
-
bioRxiv - Developmental Biology 2021Quote: ... WB following 4-20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) employed HRP-conjugated anti-HA antibody (Roche). Quantification was performed by Image J software.
-
bioRxiv - Genomics 2021Quote: ... These cells were re-suspended in lysis buffer (4% SDS, 50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 100 mM NaCl) with Protease inhibitor (Roche) and RNase inhibitor ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... tissues were incubated at 4°C in a solution of 0.05% alkaline phosphatase-conjugated DIG antibodies (Roche cat #11093274910) overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... on a rotating wheel at 4 °C and all buffers were supplemented with protease inhibitor cocktail (#11873580 001, Roche). Prior to elution ...
-
bioRxiv - Developmental Biology 2021Quote: ... WB following 4-20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) employed HRP-conjugated anti-HA antibody (Roche). Quantification was performed by Image J software.
-
bioRxiv - Molecular Biology 2020Quote: ... the subventricular zone of 4 mice from each genotype was micro-dissected and tissue digested using Liberase DH (Roche) and DNAse I (250U/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... the membranes were incubated overnight at 4° C on a rotator with primary antibody in Western Blocking Reagent (Roche), if not stated otherwise ...