Labshake search
Citations for Roche :
7501 - 7550 of 8095 citations for 7 Bromoacetyl 6 ethyl 1 2 3 4 tetrahydro 1 1 4 4 tetramethylnaphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... The LD-PCR mastermix contained 6.25 μl 2× KAPA HiFi HotStart ReadyMix (Roche Diagnostics), 0.125 μl 20 μM PCR_Satija forward primer(30) ...
-
bioRxiv - Genomics 2022Quote: ... PCR was performed by adding 10μl 2×HiFi PCR mix (Kapa Biosystems, Cat. 7958927001) and 0.5μl 60mM SINGV6 primer and running the following program ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and blocked for 60 minutes in PBS-T with 2% blocking reagent (Roche, UK), 5% foetal calf serum (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μl of 10 mM dNTPs and 10 units of Transcriptor Reverse Transcriptase (Roche).
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM EDTA pH 8.0 and 0.1% BSA supplemented with protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal ProbeLibrary Assay Design Center (Roche, Supplementary Table 2) and transcript levels of candidate genes were measured by qRT-PCR using the TaqMan hPSC Scorecard™ Panel (384 well ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... qPCR was performed using SYBR FAST ABI Prism 2× qPCR Master Mix (Kapa BioSystems). Amplification was carried out in a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The slides were incubated in blocking solution (10% sheep serum, 2% blocking reagent (Roche), 0.3% Tween-20 in MAB ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM MgCl) with with cOmplete Protease Inhibitors Cocktail (PI, Roche Diagnostics, Rotkreuz, Switzerland) and homogenized at 4 °C using a pre-cooled Potter-Elvehjem PTFE pestle at 100 RPM and glass tube with a working volume of 30 mL ...
-
bioRxiv - Microbiology 2023Quote: ... the pellets were sequentially enzymatically treated with 2 mg/ml of Pronase (Roche 165921) in 50 mM of MES (Sigma-M8250 ...
-
bioRxiv - Plant Biology 2023Quote: ... with a KAPA SYBR FAST qPCR Master Mix (2×) Kit (Kapa Biosystems, Wilmington, MA). Relative quantities were determined by the 2(-delta delta Ct ...
-
bioRxiv - Genomics 2023Quote: ... 2 μg of RNA was treated with DNase I for 30 minutes (#04716728001; Roche) and subsequently treated with 1 μl 25 mM EDTA at 70 °C for 10 minutes to inactivate DNase I ...
-
bioRxiv - Cell Biology 2023Quote: ... After physical disaggregation and digestion with 2 mg/ml collagenase B (Roche, CA, USA), the enzymatic activity was stopped by diluting with PBS 1X ...
-
bioRxiv - Microbiology 2023Quote: ... 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets, Roche), DNaseI (1 µg/ml ...
-
bioRxiv - Immunology 2023Quote: Spleens were incubated for 20 min with 2 mg/mL collagenase D (Roche, #11088858001) and then mashed through a 70-μm cell strainer ...
-
bioRxiv - Cell Biology 2023Quote: ... the stripped endothelium–Descemet’s layer was incubated with 2 mg/ml collagenase A (Roche) solution in human endothelial serum free media (SFM ...
-
bioRxiv - Biochemistry 2024Quote: ... Next, 50 µl of lytic buffer was added (2% NP-40, protease inhibitors (Roche), 0.2 µM LargeBiT (produced in house ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was treated with 2 mg/mL of pronase from Streptomyces griseus (Roche) in 50 mM Tris-HCl pH 7.0 for 1.5 h at 60°C ...
-
Faa1 membrane binding drives positive feedback in autophagosome biogenesis via fatty acid activationbioRxiv - Biochemistry 2023Quote: ... 2 mM MgCl2) and finally resuspended in lysis buffer containing complete protease inhibitors (Roche), an FY-inhibitor mix (Serva) ...
-
bioRxiv - Microbiology 2023Quote: ... DENV-2 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Immunology 2024Quote: ... 5% 2-ME) supplemented with protease and phosphatase inhibitor cocktails (#4693116001, #PHOSS-RO, Roche). A Pierce BCA Protein Assay Kit (#23225 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell pellets were lysed in 2% SDS buffer supplemented with complete Protease (Roche, 11697498001) and PhosSTOP phosphatase (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). AE1/AE3 (Leica Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... A denaturation step was performed using Cell Conditioning 2 (Roche Tissue Diagnostics, ref. 05279798001). Glut-1 (2B scientist ...
-
bioRxiv - Immunology 2024Quote: ... the cells (108/ml) were pretreated with 2 mM Pefabloc SC Plus (Roche #11873601001) for 15 min at 37 °C with rotation set to 10 RPM ...
-
bioRxiv - Genomics 2019Quote: ... and AdRb (5′ -TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16°C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... beads were collected using a magnet stand at 4 °C and washed 3 times with beads wash buffer (sperm dilution buffer supplemented 1x cOmplete EDTA-free protease inhibitor cocktail (Roche, # 4693132001), 1x PhosSTOP (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were in vitro transcribed from the linearized vector for 3 hours at 37°C with the corresponding RNA polymerase and DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel and diluted in hybridization solution for further use ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Molecular Biology 2019Quote: 800 ng of each fluorescently labelled oligonucleotide probe pool (2 μl; MyTags or Roche Probes) were added to (26 μl ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µL of LC480 SYBR Green I Master (2 X conc. Roche, Product No. 04887352001), 0.1 µL each of forward and reverse primers (20 µM ...
-
bioRxiv - Immunology 2019Quote: ... The lungs were removed and infiltrated with 2 mg/ml collagenase D (Roche, Indianapolis, Indiana) and 0.2 mg/ml DNase I (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were then digested by addition of 2 μL 20 mg/mL Proteinase K (Roche) and incubation for 2 h at 55° C ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was removed to 2 ml Eppendorf tubes and incubated with HA antibodies (Roche) for 30 min on a rotator at 4° ...
-
bioRxiv - Neuroscience 2019Quote: ... pellets were resuspended in Solution 2 supplemented with EDTA-free protease inhibitor cocktail (Roche Diagnostics), and deacetylase inhibitors (10 mM nicotinamide ...