Labshake search
Citations for Roche :
7301 - 7350 of 8095 citations for 7 Bromoacetyl 6 ethyl 1 2 3 4 tetrahydro 1 1 4 4 tetramethylnaphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and 2 μl of 10 mg/ml DNase (Roche, catalog no. 10104159001). Lymph node tissues were incubated at 37°C for 30 min and filtered through a 70 μm cell strainer ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% glycerol) supplemented with 2 mM Na3VO4 and cOmplete inhibitor mix (Roche), centrifuged (4°C ...
-
bioRxiv - Synthetic Biology 2024Quote: 2 mg of the isolated RNA was digested with DNAse I (Roche) and cDNA was synthesized using the GoScript reverse transcription kit A5001 (Promega) ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 mM 2-mercaptoethanol] containing one tablet of protease inhibitor cocktail (Roche), which can inhibit a broad spectrum of serine and cysteine proteases ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol and 2 protease inhibitor cocktail tablets (cOmplete, EDTA free, Roche)) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% sodium dodecyl sulfate (SDS)] supplemented with complete protease inhibitor cocktail (Roche Diagnostics Corp. ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 μl of RNase-free DNase I (20 μ/ml, Roche) were added to the washed antibody beads and were precipitated ON rotating at 4°C ...
-
bioRxiv - Genomics 2024Quote: ... Each PCR reaction contained 26.25Lμl 2× KAPA HiFi HotStart master mix (Roche), 2.5Lμl of 10LμM TruSeq RPIX primer (Illumina) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 μL of 2× Sybr Green (LightCycler 96, Roche Molecular Systems, Inc.), 200 nM of each primer ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 μl of 10 mg/ml DNase (Roche, catalog no. 10104159001) and incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM 2-mercaptoethanol and cOmplete Protease Inhibitor Cocktail (Roche, no. 11697498001). The cell suspension was subjected to sonication (Qsonica ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 mM DTT) supplied with EDTA-free protease inhibitor cocktail (Roche). The lysis was performed using homogenizer EmulsiFlex-C3 (Avestin) ...
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-mercaptoethanol and 10 ng/ml recombinant human IL-2 (Roche). Both human and murine CD4+ T cells were cultured for 46 hrs under humidified conditions at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Neurons were lysed in 2% Triton X-100 containing protease inhibitors (Roche). A BCA assay (Pierce ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The supernatant was applied to 2 mL of cOmplete Ni2+-agarose (Roche) prewashed with Buffer B (20 mM NaPi ...
-
bioRxiv - Neuroscience 2023Quote: ... The bill-skin was treated with 2 mg/mL collagenase P (Roche) in Krebs solution for 5 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM BME and one tablet of EDTA-free protease inhibitors (Roche)) ...
-
bioRxiv - Systems Biology 2023Quote: ... a total of 121 μL of 2× Kapa HiFi HotStart ReadyMix (Roche), 9.68 μL of PCR_PF (10 μM) ...
-
bioRxiv - Immunology 2024Quote: ... and 2 mM L-glutamine (all from Gibco)] supplemented with recombinant human IL-2 (50 U/mL; Roche, cat. 10799068001).
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 2% cOmplete EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland), 10 mM Na4P2O7 ...
-
bioRxiv - Biochemistry 2024Quote: ... the 2 ml Ni-NTA resin (cOmplete His-tag purification resin, Roche) was washed with 10 column volume (CV ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 μg/ml pepstatin and 100 µg/mL protease inhibitor cocktail (Roche). The lysate was clarified by ultracentrifugation using a TLA-55 rotor (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: Tissue sections were dissected using the reference mask image from serial section 6 to collect regions of interest using medium or large AVENIO Millisect milling tips (Roche Sequencing Solutions, Pleasanton, CA), collected with Molecular Grade Mineral Oil (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were washed twice with 0.1% Triton-X in PBS and blocked with 3% BSA (constituted from powder BSA, Roche Fraction V ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5–10 × 106 HEK-293 or MEF cells were washed with cold sucrose-containing solution I (0.5 M sucrose, 3 mM MgCl2 with Cocktail protease inhibitor, Roche), harvested by scraping into 1 ml solution I and sonicated in a BioRuptor for 10 cycles (15 sec ON/15 sec OFF) ...
-
bioRxiv - Neuroscience 2019Quote: ... The plates were then washed 3 times with ~300 μl of wash buffer (0.05%Tween in PBS) and blocked with 150 μl of 3% BSA (Fraction V, protease-free, Roche Diagnostics Corporation ...
-
bioRxiv - Immunology 2021Quote: ... The pancreas was inflated via the common bile duct by adding ∼3 ml of 0.8mg/ml Collagenase P (Roche) and 10µg/ml Dnase I (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were then washed 3 times for 5 min each in PBST and blocked with 1X Blocking Reagent (Roche) in PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... 12-20 ml of pre-warmed to 37 °C enzyme buffer solution (EBS) with 2.3 U of Liberase Blendzyme 3 recombinant collagenase (Roche) were cannulated into the vena cava to isolate hepatocytes ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μg each lysate was pre-cleared with 20 μl of Protein A agarose beads (3 mg/ml, Roche) in 200 μl for 1 hour at 4°C on a Labquake Rotator (Barnstead Thermolyne) ...
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... The pellet was resuspended with 3 ml S1 solution (0.25 M sucrose, 10 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) by pipetting up and down ...
-
bioRxiv - Physiology 2022Quote: ... for 3 min and incubated twice for 3 min with CSK buffer containing 0.5% Triton X-100 and complete protease inhibitors cocktail (catalog no. 11873580001, Roche). Cells were after washed with PBS-S ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sorted cells were pelleted for 5 min with 2000 rpm at 4°C and resuspended in 500 ul hypotonic buffer (HB; 20mM Tris-HCl, pH7.5, 10mM NaCl, 3 mM MgCl2) with added protease inhibitor (Roche). After 30min incubation on ice ...
-
bioRxiv - Immunology 2020Quote: Mice were euthanized and lungs were gently homogenized in HEPES buffer containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNaseI (30 μg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 0.5 mM CaCl2 and 1 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... then the beads were washed 3 × with washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 100 μM CaCl2 ...
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mL of Tris (pH = 8.5) and 3 tablets each of the protease/phosphatase inhibitors PhosStop and Complete Mini (Roche). Tissues were then lysed in Precellys Homogenizer Bertin (program 6 x 20s pulse ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Cancer Biology 2024Quote: ... nuclei were isolated from 5 million cells with hypotonic buffer (20 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, protease inhibitors (Roche)) for 15 min on ice ...