Labshake search
Citations for Roche :
701 - 750 of 4733 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... using the KAPA SYBR FAST qPCR Master Mix (KAPA Biosystems, Cape Town, South Africa). Each 10 µL reaction contained 1x KAPA SYBR FAST qPCR Master Mix (2.5 mM MgCl2) ...
-
bioRxiv - Plant Biology 2023Quote: ... with a KAPA SYBR FAST qPCR Master Mix (2×) Kit (Kapa Biosystems, Wilmington, MA). Relative quantities were determined by the 2(-delta delta Ct ...
-
bioRxiv - Genomics 2023Quote: ... cDNAs were used for qPCR using KAPA SYBR Fast qPCR Master Mix (Kapa Biosystems) in a QIAGEN Rotor-Gene Q ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified using LightCycler 480 SYBR Green I Master mix (Roche Diagnostics, 04707516001). The reaction mixture contained 0.15 μM specific primers (listed in Sup ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cDNA quantified using LC Fast start DNA Master SYBR Green I Mix (Roche) with primers detailed below on LightCycler480 apparatus (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with the KAPA SYBR® FAST qPCR Master Mix Kit (KAPA Biosystems, KR0389_S-v2.17). Expression values were normalized to the αTub84B gene (CG1913) ...
-
bioRxiv - Genetics 2023Quote: ... The RT-qPCR assay was carried out using FastStart SYBR Green Master Mix (ROCHE) as described previously (Alsayegh et al. ...
-
bioRxiv - Microbiology 2024Quote: ... The RT-qPCR was carried out using SYBR green master mix (Roche Applied Science) in a QuantiFast light cycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems, Wilmington, MA), 0.3 mM of each primer and 1 µL of DNA template (20 ng µL-1) ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... qPCR was performed using SYBR FAST ABI Prism 2× qPCR Master Mix (Kapa BioSystems). Amplification was carried out in a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2024Quote: ... Pooled library concentration was measured by Universal qPCR Master Mix (Kapa Biosystems, Wilmington, MA). Library quality control was performed on an Illumina iSeq100 sequencer (Illumina ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplification was performed using KAPA HiFi HotStart Ready Mix PCR kit (Roche KK2602/07958935001); 2 μL forward and reverse primer pairs (10 μM each) ...
-
bioRxiv - Neuroscience 2022Quote: ... SYBR green based PCR was performed with SYBR mix (Roche). The qPCR amplification was performed using the LightCycler 480 System (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 12.5 μL 2x KAPA HiFi HotStart PCR mix (Kapa Biosystems), and 1 μL of 25 μM PE1/PE2 index primer mix ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR amplification using KAPA2G Fast HotStart Genotyping Mix (Kapa Biosystems) with flanking oligos (S4 Table ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative PCR was performed using FAST SYBR green mix (Roche) on the ABI 7500 real-time PCR System (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR amplification was performed with KAPA 2X Ready Mix (Roche), a Taq-derived enzyme with A-tailing activity ...
-
bioRxiv - Pathology 2021Quote: ... a commercial PCR DIG-labeling mix (Roche Molecular Biochemicals, Germany). Briefly ...
-
bioRxiv - Genomics 2021Quote: ... 30μL PCR mix (25μL KAPA HiFi HotStart ReadyMix, KAPA BIOSYSTEMS KK2602 ...
-
bioRxiv - Genomics 2023Quote: ... 30μL PCR mix (25μL KAPA HiFi HotStart ReadyMix, KAPA BIOSYSTEMS KK2602 ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed using KAPA 2G ready mix by Roche.
-
bioRxiv - Neuroscience 2021Quote: ... Viral particles were quantified by real-time PCR Q-PCR using LightCycler480 SYBR Green I Master (Roche) and primers targeting the flanking sequence of ITR2 (GTAGATAAGTAGCATGGC and CTCCATCACTAGGGGTTCCTTG ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR analyses were performed using LightCycler® 480 SYBR Green I Master RT-PCR kits (ROCHE) on a Bio-Rad CFX Connect Real-Time system (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed in 25 µl reaction mix containing 2x KAPA HIFI HotStart Ready-mix (Roche #07958935001), 10µM primers and 10 ng of gDNA template from stool or tissue under the following conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... For further cDNA amplification 20 µl of PCR mix [1xKAPA HiFi Hotstart ready mix (Roche, Basel, Switzerland), 0.5 µM C1-P1-PCR-2 (5’-GAA TGA TAC GGC GAC CAC CGA T -3’) ...
-
bioRxiv - Developmental Biology 2023Quote: ... beads were resuspended in 14 μl indexing PCR Mix containing 1x KAPA Hifi HotStart Ready Mix (Roche) and 700 nM unique dual indexing primers (i5 and i7) ...
-
bioRxiv - Physiology 2019Quote: ... PCR was carried out with KAPA SYBR® FAST Universal 2X qPCR Master Mix (Cat# KK4601) / LightCycler 480 SYBR Green I Master kit (Roche Cat# 14712220) in Vapo.Protect Eppendorf LC-480 and LC-96 from Roche system using primer pairs mentioned in Supplementary Table A.
-
bioRxiv - Cancer Biology 2020Quote: ... PCR amplification was performed by adding 15µL PCR mix containing 0.5U KAPA HiFi HotStart (Kapa Biosystems), 1x KAPA Buffer (Kapa Biosystems) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCRs in this section were carried out using Kapa HiFi HotStart PCR Mix (Kapa Biosystems) in 20 μl reactions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCRs in this section were carried out using Kapa HiFi HotStart PCR Mix (Kapa Biosystems), 20 ng template and appropriate primers in 20 μl reactions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCRs in this section were carried out using Kapa HiFi HotStart PCR Mix (Kapa Biosystems) in 20 μl reactions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ARS305 probe was generated by PCR using primers ARS305_probe_F and ARS305_probe_R (Table 1) and the PCR DIG Labeling Mix (Roche). Membranes were imaged using an Azure c600 chemiluminescence Imaging System.
-
bioRxiv - Genomics 2023Quote: ... PCR amplifications were performed with Expand Long Template Enzyme mix (Expand Long Template PCR system, Roche). Oligos are available in Table S4.
-
bioRxiv - Developmental Biology 2021Quote: ... Real-Time PCR was performed using FastStart SYBR Green Master (Roche Scientific) in a LightCycler 480 system II (Roche Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR reactions were prepared using FastStart SYBR Green Master (Roche Applied Science), followed by the real-time PCR analysis using LightCycler96 (Roche Applied Science) ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCRs were performed using Fast Start Universal SYBR-green Master (Roche), with primers indicated in Supplemental Table 1 ...
-
bioRxiv - Immunology 2019Quote: ... Real-time quantitative PCR was performed using SYBR Green I Master (Roche) with the following primers (Eurogentec) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative PCR was performed using the FastStart Essential DNA Green Master (Roche) on a LightCycler 96 real-time PCR system (Roche ...
-
bioRxiv - Immunology 2022Quote: ... Real-time quantitative PCR was performed using SYBR Green I Master (Roche) with the primers described in the Key resource table (Eurogentec).
-
bioRxiv - Immunology 2021Quote: ... Samples were analyzed by real-time PCR with LightCycler Taqman Master (Roche) and Universal ProbeLibrary (UPL ...
-
bioRxiv - Cancer Biology 2022Quote: ... qRT-PCR analysis was done using FastStart Universal SYBR Green Master (Roche) on a ViiA 7 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reaction was performed using the FastStart Essential DNA Green Master (Roche) on a Lightcycler 96 (Roche) ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative PCR analyses using Sybr (LightCycler 480 SYBR Green I Master, Roche) were performed using a LightCycler 480 real-time PCR system and dedicated software (Roche) ...
-
bioRxiv - Genomics 2019Quote: ... qPCR for targeted genes was performed with FastStart Essential DNA Green Master reaction mix (Roche) on the LightCycler® 96 System (Roche) ...
-
bioRxiv - Genetics 2021Quote: ... The reaction consisted of 10 µL LightCycler FastStart Essential DNA Probes Master Mix (Roche Diagnostics), 1 µL of the primer-probe mix (20 ×) ...
-
bioRxiv - Neuroscience 2021Quote: ... 50 ng DNA were amplified using Lightcycler® FastStart DNA Master HybProbe Mix (Roche, Germany) and the respective LightSNiP Assay ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA amplication was carried out with Light-Cycler 480 SYBR Green I Master mix (Roche) on the Stratagene Mx3005P QPCR system (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR reactions (0.5 μl cDNA, 0.2 μM each primer, SYBR green Master Mix (Kapa biosystems) were performed on a Roche LightCycler 480 Real-Time PCR detection system ...
-
bioRxiv - Immunology 2022Quote: ... 200 nM specific TaqMan probe (TM) and the LightCycler® Multiplex RNAVirus Master mix (ROCHE). The programs were ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR reactions were prepared using 5 μL of FastStart SYBR Green Master mix (Roche Diagnostics) with a final concentration of 1μM of each primer ...