Labshake search
Citations for Roche :
701 - 750 of 8575 citations for N 2 Chloro 5 1 oxo 2 3 pentadecylphenoxy butyl amino phenyl 4 4 dimethyl 3 oxovaleramide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The cells were lysed via sonication and lysate was clarified by centrifugation (17,000 rpm for 1 hour at 4°C) ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were blocked for 2 hours in blocking solution (1% blocking reagent; (Roche, 11096176001) in malic acid buffer (0.15M maleic acid ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cell pellets were treated with 1 mL of 2 mg/mL lysozyme (Roche, Switzerland) and incubated at 30 °C for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM 2-Mercaptoethanol and 6 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 8.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked with 3% skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (1:1,000, Roche) or rabbit anti-aldolase (Mesén-Ramírez et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 mM KCl, 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 0.1 mM GTP, 3 U/ml benzonase, 1X Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 µL protein breakage buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 20 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to the samples ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Biochemistry 2024Quote: ... resuspended in lysis buffer (20 mM Tris-HCl, pH 7.5, 300 mM NaCl, 0.5 mM TCEP, 1× Benzonase, 3× protease inhibitor cocktail [Roche cOmplete]), and lysed using a cell disruptor at 1.5 kbar ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were fixed with 2% paraformaldehyde/ 2% sucrose for 20 min and stained with DAPI (#10236276001, Roche) to visualize anaphases ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature and incubated with primary antibodies overnight at 4°C against either HA (1:5000, Roche 12013819001), FLAG (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated overnight at 4°C in 1% goat serum in MABT with 1∶5000 alkaline phosphatase-coupled anti-Digoxigenin antibody (Roche Diagnostics). On the third day ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 M urea, 0.5% SDS, 1 mM EDTA pH8.0, 1 mM DTT, and 1× protease inhibitor cocktail [Roche, cat#4693132001]). Biotinylated RBPs were captured by affinity purification ...
-
bioRxiv - Microbiology 2020Quote: ... The cross-linking reaction was quenched by incubating the cells with 0.125 M glycine for 5 min with mild agitation at room temperature followed by centrifugation at 3,000 rpm for 5 min at 4°C with a subsequent PBS wash (containing 0.01X protease inhibitor cocktail or PIC; #11836170001, Roche Applied Science, Indianapolis, USA). Following the complete removal of PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... 100 µl 10% SDS, 500 µl 20% N-Lauroyl sarsosine sodium, 2 tablets of cOmplete ULTRA Protease Inhibitor Cocktail [Roche Cat.# 05892970001] in 10ml FA buffer). For each IP experiment ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were lysed using 2-5 times the volume of RIPA lysis buffer supplemented with 1x protease inhibitor cocktail (Roche), PMSF (1 mM ...
-
bioRxiv - Microbiology 2021Quote: ... the remaining dermis was washed in Ca2+ and Mg2+ free PBS 5 times and incubated in a digestion buffer containing 2 mg/ml collagenase A (Roche), 100 µg/ml of DNase I (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Biochemistry 2023Quote: ... cell pellets were resuspended in HR buffer (50 mM Tris-HCl, 5 mM MgCl2, 250 mM sucrose, 2 mM TCEP and protease inhibitor t (Roche), pH 7.4) ...
-
bioRxiv - Cancer Biology 2023Quote: ... glands were minced into paste and incubated in 5 mL DME/F-12 medium (HyClone, #SH30023.1) with 2 mg/mL collagenase A (Roche #10103578001), 100 units/mL hyaluronidase (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... The loci of interest were first amplified with 15 cycles of PCR from 2 μL (∼100 ng) of genomic DNA eluate using a 5 μL Kapa HiFi HotStart polymerase reaction (Roche). The first PCR was then diluted with 25 μL of DNAse-free water ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2-10 5 micron sections were extracted using the High Pure FFPE RNA Isolation kit (Roche Life Sciences, Penzberg, Germany) under RNase free conditions following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... with probe prepared by nick translation of a double-stranded PCR product bearing the bcd ORF using alkali-stable digoxigenin-11-2’-deoxyuridine-5’-triphosphate (Roche), visualizing with alkaline-phosphate coupled sheep anti-digoxigenin Fab fragments (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... then with 1 ml of Western blot buffer (2% SDS, 5% Glycerol, 50 mM Tris-HCl, 0.2 M EDTA + cOmplete protease inhibitor cocktail tablet (Roche, 11697498001) + PhosSTOP (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 0.1% SDS, 2 mM EDTA, 1 mM PMSF, Roche protease and phosphate inhibitor cocktails ...
-
bioRxiv - Cell Biology 2020Quote: ... then resuspended in 4°C homogenization buffer (0.6 M sorbitol, 10 mM Tris pH 7.4, 1 mM EDTA, 1 mM PMSF, 2× Roche cOmplete protease inhibitor cocktail ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-DIG-POD (Roche Cat. N: 11207733910, 1:500) and Anti-FITC-POD (Roche Cat ...
-
bioRxiv - Cell Biology 2022Quote: ... Pellets were resuspended in 120 μl lysis buffer (0.1 M NaOH, 0.05M EDTA, 2% SDS, 2% beta-mercaptoethanol, PhosStop (Roche), cOmplete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2020Quote: ... blocked in 3% BSA and probed with anti-HA (clone 12CA5, Roche), anti-cMyc (clone 9E10 ...
-
bioRxiv - Neuroscience 2020Quote: ... Following resuspension in (3 ml) homogenization medium containing protease inhibitor (Roche Diagnostics), the cells were cracked open using a ball bearing homogenizer with a 0.2507-inch bore and 0.2496-inch diameter ball ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The cartilage was then incubated in 3 mg/mL Collagenase D (Roche) in DMEM solution for two 45 minute periods and transferred to 0.5 mg/mL Collagenase D in DMEM solution supplemented with 3% Liberase TL (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei lysates (in Nuclear Buffer Lysis 3, supplemented with protease (Roche, 11697498001) and phosphatase inhibitors (1 mM Na3O4V (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche, KK2502) were added to the annealed oligos ...
-
bioRxiv - Microbiology 2024Quote: ... 3 mM MgCl2) supplemented with complete Protease inhibitor cocktail tablets (Roche 11873580001). The lysates were incubated on ice for 1 hour and centrifugated at 20,000 x g for 15 minutes at 4°C to pellet the nuclear fraction ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with 4-Nitroblue tetrazolium chloride (NBT, Roche) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Biophysics 2020Quote: ... 4 mM digitonin and EDTA-free protease inhibitor tablets (Roche). Insoluble material was removed by ultracentrifugation at 100,000 g for 30 min ...
-
bioRxiv - Physiology 2020Quote: ... 4 µL of 0.25 µg/µL trypsin (Roche, sequencing grade) was added to each sample and left overnight at 37 °C.
-
bioRxiv - Molecular Biology 2021Quote: ... 4 ul of 20 mg/ml proteinase K (Roche 3115801) was added ...