Labshake search
Citations for Roche :
601 - 650 of 8575 citations for N 2 Chloro 5 1 oxo 2 3 pentadecylphenoxy butyl amino phenyl 4 4 dimethyl 3 oxovaleramide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... 5 mM EDTA, 2% Triton-X-100, 0.2 mM HDSF, pH 7.4, and protease inhibitor cocktail from Roche). Following sonication on ice ...
-
bioRxiv - Cell Biology 2023Quote: 12-16 hours old embryos were collected and lysed in homogenization buffer (25 mM Hepes pH 7.4; 150mM NaCl; 0.5mM EDTA pH 8.0; 1 mM DTT and 1 tablet of proteinase inhibitor cocktail; Roche 11836170001). The aqueous phase of the lysate was collected after 1 hour of centrifugation at 4°C and centrifuged again for 25 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μL of each sample was used for qPCR with 2 × Sybr Green (Roche) and primers for human RPLP2 (housekeeping gene) ...
-
bioRxiv - Microbiology 2022Quote: ... (2) the quantitative Roche Spike Elecsys Anti-SARS-Cov-2 S assay (Roche, IND, USA), which measures spike total antibody concentrations ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM DTT supplemented with 1×cOmplete EDTA-free protease inhibitor cocktail (Roche), 1×PhosSTOP phosphatase inhibitor (Roche) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mg ml−1 iodoacetamide supplemented with Complete Protease Inhibitor Cocktail tablets (Roche) for 1 h at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mg ml−1 iodoacetamide supplemented with cOmplete Protease Inhibitor Cocktail tablets (Roche) in Dounce homogenizer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% Penicillin/Streptomycin and 20 IU human IL-2 (Roche Diagnostics, Mannheim, Germany) for 5d ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT and 2 tablets of Complete Protease Inhibitor Cocktail Tablets (Roche) per 100 ml lysis buffer) ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT and 2 mM MgCl2) supplemented with 1x protease inhibitor (Roche) and 1 µl benzonase (Merck) ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM of phosphatase inhibitors (β-glycerophosphate, NaF and NEM) and 1 tablet of PhosStop (Roche)) ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were incubated overnight at 4 °C with rat anti-HA Abs at 1:200 (Roche) and guinea-pig anti-red fluorescent protein (RFP ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown in 10 μM BrdU:BrdC (3:1) for 16–20 h before incubation with 0.1 μg/mL colcemid (Roche) for 2-3 h ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Rap1GAP- RlucII/rGFP-CAAX + Gαi2 and D2 or PDZ-RhoGEF-RlucII/rGFP-CAAX + Gα13 and TPαR) using X-tremeGENE 9 DNA transfection reagent (3:1 reagent/DNA ratio; Roche) diluted in OptiMEM (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were harvested and lysed in IP buffer (1 x PBS, 3 mM KCl, 2.5 mM MgCl2, 0,5 % Triton X-100 and protease inhibitors from Roche). 35 μl of this lysate was loaded onto an SDS-gel (lysate lanes) ...
-
bioRxiv - Biochemistry 2020Quote: ... PFN1-KO or PFN2-KO) were split 1:3 and the next day transfected using XtremeGene 9 (Roche) with 5 μg V5-NAA80 (M23L ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:3 and qRT-PCR was conducted using a SYBR Green master mix (Roche, FSUSGMMRO) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... planulae were washed twice with 1/3 strength artificial seawater and incubated with 50 μg/mL liberaseTM (Roche) at 37 °C for 10–20 min with occasional pipetting ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sample was incubated for 2 h with 2 μl of 20 mg/ml ProteinasK (Roche), and subjected to AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were blocked in 2% TNB (2% blocking reagent (Roche, REF 11 096 176 001) in TNT for 2-3 h at room temperature and incubated with an anti-Fluo-POD antibody (1/50 ...
-
bioRxiv - Microbiology 2024Quote: ... interleukin-2 (IL-2; specific activity 10 U/ng) at concentration of 20 ng/mL (Roche) and phytohemagglutinin (PHA ...
-
bioRxiv - Immunology 2023Quote: ... the medium was supplemented with 30 IU/mL recombinant human interleukin 2 (IL-2) (Proleukin, Roche). Electroporated T cells were kept in culture ON and then used directly or frozen.
-
bioRxiv - Genomics 2024Quote: ... with 2% BSA and resuspended in NEB+ (NEB with 2% BSA, 1U/ml proteinase inhibitor Roche #3335402001 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were lysed with 4% SDS lysis buffer (4% SDS, 150 mM NaCl, 50 mM triethanolamine pH 7.4, Roche protease inhibitor, benzonase). Protein concentrations were determined by the BCA assay (Pierce) ...
-
bioRxiv - Genomics 2024Quote: ... for which we could confirm their differential methylation between 4 Col-WT and 4 Col-ddm1 plants by comparing digested and non-digested samples using qPCR (Roche LightCycler 480). We then measured methylation states using this method on DNA extracted using Macherey-Nagel 96-well plate extraction kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated with blocking buffer (4 % skim milk in 1 × PBS) followed by incubation with the primary antibody: (monoclonal anti-GFP mice 1:5000 (Roche), rabbit anti-GFP 1:10000 ...
-
bioRxiv - Pathology 2020Quote: ... Tween-20 0.1%) for 1 hour and incubated overnight at 4 °C with the appropriated antibodies: HA (dilution 1:1000, Roche, #867423001), ß-tubulin (dilution 1:5000 ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were washed and incubated overnight at 4 °C with an alkaline phosphatase-conjugated anti-digoxigenin antibody (1:2500-1:4000, Roche). To visualize the RNA-probe binding ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were lysed in Buffer A (2 M NaCl, 20 mM HEPES pH 7.5, 20 mM Imidazole, 5 mM βME, protease inhibitor (Roche)) by sonication ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG-labelled cDNA probe was incubated at 95 °C for 10 min and immediately placed in the ice for 5 min before adding to the hybridization buffer (5x SSC, 50 % formamide, 0.02 % SDS, 2 % blocking agent (Roche), DEPC-treated water) ...
-
bioRxiv - Neuroscience 2023Quote: ... cells and sections were processed for BrdU immunodetection following the manufacturer’s recommendations (5-Bromo-2′-deoxy- uridine Labelling and Detection Kit I, Roche). The slides were mounted for fluorescent microscopy in ProLong® Diamond Antifade Mountant with DAPI (Life Technologies).
-
Conserved Cis-Acting Range Extender Element Mediates Extreme Long-Range Enhancer Activity in MammalsbioRxiv - Genomics 2024Quote: ... embryos were with PBT (x3, 15mins) and incubated in prehybridization buffer (50% deionized formamide, 5× SSC, pH 4.5, 2% Roche Blocking Reagent ...
-
bioRxiv - Physiology 2024Quote: Fibroblast proliferation was assessed using a 5-bromo-2’-deoxyuridine (BrdU) incorporation assay (colorimetric) from Roche (Indianapolis, IN, USA) for 48 h following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... and glands minced with surgical scissors before enzymatical dissociation for 1.5h in DMEM/F12 (1:1) supplemented with 2 mg mL−1 collagenase (Roche) + Gentamicin (Gibco) ...
-
bioRxiv - Cancer Biology 2021Quote: ... dry milk or 2% BSA (Roche), membranes were probed with primary antibody (dilution 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% BSA fraction V (Roche Diagnostics), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Immunology 2021Quote: ... 2 mg/mL Collagenase VIII (Roche) and 0.5 mg/mL DNAse I (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 pg of E.coli rRNA (Roche) was added as spike-in to equal volumes of RNA extracted from sucrose gradient fractions for the reverse transcription ...
-
bioRxiv - Bioengineering 2021Quote: ... and 30U/ml hIL-2 (Roche). After 2 days ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of DNase I (Roche), and 1 μl of RNase OUT (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... 2 mg/ml collagenase D (Roche), and 1.5 mg/ml DNase I (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL] ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL solution] at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... we used 2% Blocking Reagent (Roche) in PBS with 0.1% Tween-20 ...