Labshake search
Citations for Roche :
701 - 750 of 2089 citations for Adenovirus Type 5 Particles CMV GFP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and pLenti-Luc-GFP (6 µg) into HEK293T cells using X tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Gary Eitzen (University of Alberta)) and anti-GFP from mouse (clones 7.1 and 13.1; SKU 11814460001; Roche), and secondary antibodies ...
-
bioRxiv - Plant Biology 2019Quote: ... the membrane was probed with a 1:20000 dilution of mouse anti-GFP antibody (JL-8, Roche) or mouse anti-alpha-tubulin antibody (B-511 ...
-
bioRxiv - Developmental Biology 2019Quote: The following primary antibodies were used in the specified concentrations: mouse anti-GFP (1:1000, Roche #11814460001), rat anti-HA (1:1000 ...
-
bioRxiv - Plant Biology 2021Quote: ... The eluted proteins were subjected to 10% SDS-PAGE gels for immunoblot analyses using anti-GFP (Roche) and anti-Myc (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies against the following antigens were used at the indicated dilutions: GFP (Mouse, 11814460001, Roche, 1/5000), HA (Rabbit ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-Trap beads were collected and washed five times (50mM Tris-HCL pH 7.4, 150mM NaCl, Roche complete Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were probed overnight at 4 °C with anti-GFP primary antibodies (Roche 11814460001; 1:1000) and then with anti-mouse peroxidase-conjugated secondary antibodies (Jackson Immunoresearch # 115-035-146 ...
-
bioRxiv - Cell Biology 2022Quote: ... the following antibodies were used (all at 1:3000 dilution): α-GFP (Roche, 11 814 460 001), α-Pgk1 (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The membranes were blocked with 3 % skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (clone 7.1 and 13.1; 1:1,000, Roche) or rabbit anti-aldolase64 (1:2,000) ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse monoclonal IgG1k anti-GFP (clones 7.1 and 13.1, 1:100 for immunoprecipitation, Roche, catalog no. 11814460001), IgG2b anti-GFP (clone GT859 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... The primary and secondary antibodies used in western blot analysis were: mouse anti-GFP (1:1000, Roche), mouse anti-PLK4 (1:500 ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies used in this study were mouse monoclonal antibodies: GFP (clones 7.1 and 13.1; 11814460001; Roche, Germany) (1:2,000 for WB) ...
-
bioRxiv - Biochemistry 2023Quote: The flow chamber was incubated with 10 μl anti-GFP (Roche, 500 μg/ml in PBS buffer) for 2 min and subsequently washed twice with 10 μl BRB80-Casein (80 mM NaOH Pipes pH 6.8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membrane was probed using the primary antibodies mAb mouse α-GFP (1:1’000, Roche Diagnostics #11814460001), mAb mouse α-PfGAPDH (1:20’000 ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were subjected to Western blotting analysis using an anti-GFP antibody (Roche, Cat. No. 11814460001) at a dilution of 1:1,000 and an anti-Myc antibody (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were subjected to Western blot analysis with mouse monoclonal anti-GFP antibody (1:2,000 dilution, Roche), rabbit polyclonal anti-Sec2 antibody (1:2000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were then either immunoprecipitated by adding 2 μg mouse anti-GFP (Clones 7.1 and 13.1, Roche) and protein G sepharose beads or ALFA selector ST beads (NanoTag Biotechnologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... CFP/GFP and mCherry probes were synthesized using the PCR digoxigenin probe synthesis kit (1163090910, Roche, Switzerland) with primers shown in Table 1 and the following PCR conditions ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by 1 hour antibody incubation (α-GFP, monoclonal mouse antibody, Roche, catalog no. 11814460001, 1:1000). After three washes with TBST for 10 min each ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated overnight with primary antibody (monoclonal anti-FLAG, 1:10,000, Sigma #F1804-5MG; anti-GroEL, 1:10,000, Sigma; or anti-GFP, 1:10,000, Roche #11814460001 in 3% bovine serum albumin (BSA)/TBS-T ...
-
bioRxiv - Cancer Biology 2020Quote: ... HPV DNA capture was performed with NimbleGen’s SeqCap EZ Custom Library containing probes for all HR HPV types (Roche NimbleGen, Inc.,) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated in enzyme mix for tissue dissociation (collagenase type II enzyme mix (Gibco, 17101-015, 5mg/ml dissolved in Basis medium, DNase: 15ug/ml (Roche, 10104159001) and 10 μM Y-27632-HCl Rock inhibitor (Selleckchem ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated in enzyme mix for tissue dissociation (collagenase type II enzyme mix (Gibco, 17101-015, 5mg/ml dissolved in Basis medium, DNase: 15ug/ml (Roche, 10104159001) and 10 μM Y-27632-HCl Rock inhibitor (Selleckchem ...
-
bioRxiv - Genetics 2023Quote: ... We performed copy number qPCR using genomic DNA from three humanized and three wild type individuals using Light Cycler 480 SYBR Green I Master Mix (Roche #04707516001). The biological replicates for each individual were run in triplicate and error bars show the standard deviation from these technical replicates ...
-
bioRxiv - Physiology 2023Quote: ... Then the heart was perfused with the same solution containing 1 mg/mL collagenase Type A (Catalog # 9036-06-0; Roche, Germany) and 0.08 mg/mL protease Type XIV (Cat log # 48655321 ...
-
bioRxiv - Cancer Biology 2019Quote: ... the cell pellets were resuspended in lysis buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 % NP-40, 5 mM MgCl2, 5 % glycerol and protease inhibitor cocktail [Roche]) and incubated for 20 min at 4 °C with end-over-end rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100, and 1x complete protease inhibitor [Roche]). Cleared lysates were then incubated with glutathione sepharose (GE healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The enzyme digestion was carried out by digestion buffer (calcium-free Tyrode buffer supplemented with hyaluronidase [Worthington, 0.1 mg·ml-1, LS005477] and collagenase type B [Roche, 0.35 U·ml-1, 11088807001]). The left ventricle was collected after 10 minutes’ digestion and cut into small pieces ...
-
bioRxiv - Genetics 2020Quote: ... cells were transfected with 3 μg of either wild-type (BBS2-WT-V5) or mutant BBS2 constructs (BBS2P134R-V5 and BBS2R275X-V5) using FuGENE HD (Roche, Branford, CT) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... tissue sections (n = 2-3 per tissue type) underwent deparaffinization and heat-mediated antigen retrieval on the Ventana Discovery Ultra auto-stainer platform (Roche Diagnostics, Canada), following the below instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Systems Biology 2019Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM b-glycerophosphate, 5 mM NaF, 1 mM Na3VO4 and protease inhibitors (Roche cOmplete ULTRA Tablets ...
-
bioRxiv - Neuroscience 2019Quote: ... Striatum and ventral midbrain from injected and non-injected hemispheres were rapidly dissected and homogenized with 6 volumes of Triton lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton-X100, 1 mM EDTA, 1X EDTA-free Complete protease inhibitor cocktail [Roche] and 1X phosphatase inhibitor cocktail 2 and 3 [Sigma]) ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was diluted 1:10 or 1:5 and 5 μl or 2 μl was used with the Light Cycler Syber Green master mix (Roche), or AMPLIFY ME SG Universal Mix (Blirt) ...