Labshake search
Citations for Roche :
7251 - 7300 of 8559 citations for 6 Methyl 2 3 4 9 tetrahydro 1H carbazol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sequencing libraries were prepared from 1 µg of total RNA using a Kapa mRNA HyperPrep kit (Roche, KK8580) per the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... The purified parasites were lysed in 200 μl RIPA buffer (150mM NaCl, 10 mM TrisHCl, pH 7.5, 0.1% SDS, 1% TX100 containing 2x protease inhibitor cocktail (Roche), and 1 mM PMSF ...
-
bioRxiv - Biophysics 2024Quote: ... A second PCR amplification was performed with KAPA HiFi (KAPA Biosystems; 1-μL qPCR template, 15 cycles maximum). We amplified corresponding regions of pSC101_TetR_specR with primers that linearized the backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100) complemented with final concentration of 1X EDTA-free Complete protease inhibitor cocktail (34044100, Roche) and 1 mM PMSF (78830 ...
-
bioRxiv - Immunology 2023Quote: ... and the surface was immersed in 200 µl of ice-cooled gut buffer [1× protease inhibitor cocktail (Roche), 0.2 mg/mL trypsin inhibitor from soybean (Thermo fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were then resuspended in sonication buffer (50 mM Tris-HCl pH 8.1; 10 mm EDTA; 1% Triton-X; 0,1% deoxycholate sodium; 100 mM NaCl, 1mM PMSF, Proteinase inhibitor Roche) and sonicated 6 times with 2 min cycles (Branson Sonifier 250 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Riboprobes produced as described above were detected using alkaline-phosphatase-conjugated anti-digoxigenin Fab fragments (1:2000, [Roche]). Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Pathology 2023Quote: ... The slides were steamed for 32 minutes in Cell Conditioning 1 (CC1) solution (Cat. # 950-500, Roche Diagnostics) for antigen retrieval ...
-
bioRxiv - Neuroscience 2023Quote: ... brain sections were incubated with horseradish peroxidase (HRP)-conjugated anti-Dig (Roche Applied Science cat#11207733910, 1:500) and anti-GFP (Aves Labs cat#GFP-1010 ...
-
bioRxiv - Plant Biology 2023Quote: ... membranes were cut and immunodetected with either Horse Radish Peroxidase (HRP)-conjugated 3F10 anti-HA (1:2000, Roche) or HRP-conjugated Flag M2 (1:2000 ...
-
bioRxiv - Immunology 2023Quote: ... Lungs were perfused with sterile PBS and digested for 1 hour with 625µg/mL collagenase D (Roche 11088875103) and 75U/mL DNase I (Sigma D4527) ...
-
bioRxiv - Neuroscience 2023Quote: Tissues were diluted in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 1% Triton-X100, freshly added protease/phosphatase inhibitors [Roche]), and homogenised using stainless steel beads and a QIAGEN TissueLyser II (shaking 1 min ...
-
bioRxiv - Plant Biology 2023Quote: Total proteins were extracted from 6 g of frozen ground Arabidopsis seedling tissue with IP buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% NP-40, 1% Triton, EDTA-free protease inhibitor cocktail [Roche]). Lysates were cleared by centrifugation (6,000 g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1% Triton X-100) supplemented with 1X complete protease inhibitor cocktail and 1X complete phosphatase inhibitor cocktail (Roche) using a Precellys Evolution homogenizer (Bertin Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Plant Biology 2023Quote: ... cells were ruptured by bead beating in lysis buffer (50 mM Tris-pH 8.0, 1 mM DTT, 0.5 mM PMSF and 2x PhosStop EASYpack-Roche) for 7 cycles with 30 seconds of beating at 400 rpm and 45 seconds on ice for each cycle ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used in this study and their respective dilutions were: mouse monoclonal anti-GFP at 1/1000 (clones 7.1 and 13.1, Roche), mouse monoclonal anti-TY at 1/200 (53) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the mixture was resuspended in buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 1× Roche cOmplete protease inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were washed three times (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-7 washing steps with wash buffer (25 mM Hepes pH 7.4; 150mM NaCl; 0.5mM EDTA pH 8.0; 1 mM DTT and ½ tablet of proteinase inhibitor cocktail, Roche 11836170001) were performed before the beads were either sent for mass spectrometry or prepared with the appropriate amount of SDS for SDS/PAGE and Western blot ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used in this study and their respective dilutions were mouse monoclonal anti-GFP at 1/1000 (clones 7.1 and 13.1, Roche), mouse monoclonal anti-TY at 1/250 (53) ...
-
bioRxiv - Biochemistry 2023Quote: ... 30% glycerol [w/vol] and bromophenol blue) and 1 µl of proteinase K (14–22 mg/ml, Roche) and incubating at 37 °C for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... the cells were lysed in 1 ml of mild lysis buffer containing protease inhibitor mixture (Roche Life Sciences) and phosphatase inhibitor mixture (EMD Millipore) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysis was performed with Buffer NP40 (50mM Hepes pH 7.5, 150mM KCl, 2mM EDTA, 0.5% NP40, 1mM DTT, and 1 Roche protease inhibitor tablet for 10 mL of buffer).
-
bioRxiv - Cell Biology 2023Quote: Cells were re-suspended in 0.1% NP-40-PBS (1ml/1×107 cells) with 1X Protease Inhibitors (Roche) and 1mM DTT ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris-HCl pH 8.0, 5 mM MgCl2, 0.25% IGEPAL CA-630, 1 mM DTT, cOmplete protease inhibitor [Roche]) and mixed with 200 µL of 3 µg µL−1 nuclear extract and 500 µL PBB+ buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris-HCl pH 8.0, 0.25% IGEPAL CA-630, 1 mM DTT, 5 mM MgCl2, cOmplete protease inhibitor by Roche). Per replicate and construct ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris-HCl pH 7.5, 0.5% IGEPAL CA-630, 5 mM MgCl2, 1 mM DTT, 1x protease inhibitor EDTA free [Roche]) and mixed with 50 µL PBB-buffer-equilibrated MyOne Streptavidin C1 Dynabeads (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... tissue slides were heat pre-treated using a Cell Conditioning Buffer 1 (pH 8) (Roche Diagnostic, Meylan, France) at 98°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 2x Complete EDTA-free protease inhibitor [Roche]), and insoluble material and lipid were cleared by centrifugation at 16,000 g for 15 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 1 µg/mL plasmid DNA using Fugene HD transfection reagent (Roche Diagnostics, Indianapolis, IN).
-
bioRxiv - Cell Biology 2023Quote: ... 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM DTT, 50 mM sodium fluoride, protease inhibitors [Roche]). Triton X-100 (0.1% ...
-
ENGRAILED-1 transcription factor has a paracrine neurotrophic activity on adult spinal α-motoneuronsbioRxiv - Neuroscience 2023Quote: ... 50 mM Tris-HCl pH8.0, 0.3 M NaCl, Triton X-100 1%, EDTA-free Complete Proteases inhibitor cocktail from Roche and 250U/ml of benzonase endonuclease from Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... spun at 20,000 × g for 5 min was mixed with 75 μl of RNA pulldown buffer (1× PBS, 0.1% Triton X-100, 0.6 mM PMSF, and complete EDTA-free protease inhibitor cocktail [Roche]) (final protein concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... The NEs were diluted with IP buffer (1× PBS, 0.1% Triton X-100, 0.6 mM PMSF, and cOmplete EDTA-free protease inhibitor cocktail [Roche]) (protein concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... the coverslips were incubated with 1× blocking solution (Blocking Reagent [Roche] and TBST [TBS and 0.1% Tween 20]) at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM DTT, 50 mM sodium fluoride, protease inhibitors [Roche]). Then was added Triton X-100 at a final concentration of 0.1% and the cells were incubated for 5 min on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was removed and the cell pellet washed in lysis buffer 2 (200 mM NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.5 mM EGTA, cOmplete protease inhibitor by Roche). Cells were taken up in sonication buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 min) and the cell pellet was resuspended in 1 ml vPBS containing EDTA-free protease inhibitor (Roche). The cells were pelleted again by centrifugation (750 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... and the fixed cells were then resuspended in 1 ml RT vPBS containing EDTA-free protease inhibitor (Roche). The cells were attached to the coverslips by centrifugation (1000 x g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Genetics 2023Quote: ... The cell pellet was dried overnight and then lysed with glass beads in lysis buffer (Tris-HCl [pH 7.5], 1 mM EDTA, 2.75 mM DTT, protease inhibitor cocktail (cOmplete EDTA-free [Roche]). Next 3x SDS sample buffer (187.5 mM Tris [pH 6.8] ...
-
bioRxiv - Microbiology 2023Quote: Cell lysates were harvested at indicated time points using RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclear pellets were resuspended in shearing buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl pH 7.5, 1X Roche protease inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... Bacterial pellets were collected via centrifugation at 4°C and 5,000g and resuspended in ice-cold lysis buffer (50 mM MES pH 6.8, 1 mM EGTA, 0.2 mM MgCl2, 5 mM DTT, Roche complete protease inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... Beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...