Labshake search
Citations for Roche :
7251 - 7300 of 8217 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... samples were collected and plasma HIV RNA levels tested by quantitative rRT-PCR (Roche Cobas Ampliprep/Cobas Taqman HIV-1 test, Roche Diagnostics, Mannheim, Germany) at the NICD.
-
bioRxiv - Neuroscience 2022Quote: ... and washed once with HK buffer (25mM HEPES pH 7.2, 150mM KCl, 1mM DTT, 1 mM EDTA, Protease Inhibitors (Roche, EDTA-free cOmplete tabTM)) ...
-
bioRxiv - Neuroscience 2022Quote: ... The supernatant was aspirated and the pellet was resuspended in a pre-warmed digestion mix containing 1 mg ml-1collagenase/dispase (Roche Diagnostics, Indianapolis, USA) and 10 μg ml-1DNase I (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2022Quote: ... Heart tissue was homogenized on ice using Tissue Tearor at medium speed for 1 minute in lysis buffer (RIPA plus 0.1% SDS with Roche EDTA-free protease inhibitor) and allowed to sit on ice 10 minutes followed by sonication using Branson sonifier at 10% amplitude ...
-
bioRxiv - Genomics 2023Quote: ... DNA-Seq libraries were prepared from 1 mg of DNA extracted from young leaves using the Kapa LTP library prep kit (Kapa Biosystems, MA, USA). After quantity and quality evaluation with the High Sensitivity chip of a Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Immunology 2024Quote: ... Brains were homogenized using a glass Potter and digested for 45 min at room temperature (RT) in Hanks’ balanced salt solution (HBSS) medium with collagenase D (1 mg/ml, Roche Diagnostics cat # 11088882001) and deoxyribonuclease (DNase ...
-
bioRxiv - Genomics 2024Quote: ... the tissue fragments were transferred into a Douncer homogenizer containing a protease inhibitor cocktail (PIC, Roche, 1 tablet in 50 ml of PBS) solution immersed in ice and homogenized using pestles A and B (from less to more plunger adjustment) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 s off for 1 min at power 10 microns of amplitude) in ice-cold buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001)) and spun down at 13,000 g at 4 °C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Pellet was resuspended in 7 mL of buffer (50 mM Hepes pH 7.4, 150 mM NaCl, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001)) and subjected to 20 strokes in Dounce homogenizer ...
-
bioRxiv - Cell Biology 2024Quote: ... Pellet was resuspended in 7 mL of buffer (50 mM Hepes pH 7.4, 150 mM NaCl, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001)) and subjected to 20 strokes in Dounce homogenizer ...
-
bioRxiv - Microbiology 2023Quote: Cell pellets were resuspended in 300 μL of buffer 1 (20 mM K-HEPES pH 7.9, 50 mM KCl, 10% glycerol and Roche EDTA-free protease inhibitors). Samples were sonicated on ice using a probe-type sonicator (4 cycles of 15 s with 15 s resting on ice ...
-
bioRxiv - Molecular Biology 2022Quote: ... sections underwent a series of saline sodium citrate buffer washes and were incubated with anti-DIG-AP fab fragments (Roche, 11093274910, 1:1000) O/N at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: RNA was obtained from epithelioids 1 week after medium change to mFAD or from mouse esophageal epithelium peeled and incubated with Dispase I (Roche catalog no. 04942086001) diluted at 1 mg/ml in PBS for 15 min ...
-
bioRxiv - Immunology 2023Quote: ... The gut was then added to a 1.5 mL Eppendorf tubed filled with 1 mL pre-warmed 37°C collagenase/dispase solution (Roche 10 269 638 001) and incubated for 90 seconds before adding to a 40-micron filter as above ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM Na-β-Glycerophosphate and 1% (v/v) TritonX-100 and immediately prior to use the buffer was supplemented with cOmplete™ protease inhibitor cocktail (Roche. Cat# 04693116001).
-
bioRxiv - Cell Biology 2023Quote: ... Protein expression was determined by solubilizing 2–4 x 106 cells in lysis buffer (1% Triton X-100, 150 mM NaCl, 0.5 mM EDTA) plus 2X protease inhibitor cocktail (Roche Applied Science, Boulder, CO). Samples were analyzed by SDS-PAGE and Western analysis was performed using either mouse anti-FLAG antibody (1:1000 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 mM Tris-HCl pH 7.5/140 mM NaCl/1% NP-40/1% sodium deoxycholate/0.1% sodium dodecyl sulfate (SDS)) and 150 μL of Complete Mini protease inhibitor cocktail (Roche Diagnostic Systems, Laval, Canada). Harvested cells were sonicated using three 12-second bursts of a Sonic Dismembrator (model 500 ...
-
bioRxiv - Immunology 2024Quote: ... lungs were minced with scissors and then enzymatically digested for 45 min at 37°C in RPMI-1640 medium supplemented with 1 mg/ml Collagenase D (Roche-Diagnostics, Indianapolis, IN), 1 mg/ml hyaluronidase ...
-
bioRxiv - Immunology 2024Quote: ... THP-1-monocyte-derived IFN-γ-primed macrophages were induced by co-stimulation with PMA and 100 U/ml human IFN-γ (Roche, 11040596001) for 24 h ...
-
bioRxiv - Biophysics 2024Quote: ... The pellet was resuspended in 50 ml lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, Roche Complete protease inhibitor cocktail) and the lysate was boiled for 20 min ...
-
bioRxiv - Neuroscience 2024Quote: ... were homogenized with a pre-chilled Dounce homogenizer using RIPA buffer (50 mM Tris-HCl, 250 mM sucrose, 1 mM EDTA, and Roche protease inhibitor tablet). Tissue lysates were cleared by cold centrifugation ...
-
bioRxiv - Neuroscience 2024Quote: NPCs or iPSCs were lysed with HKT buffer (25mM HEPES pH 7.2, 150mM KCl, 1% Triton X-100, 2mM DTT, 1x protease inhibitor (Roche, cOmplete™ EDTA free), 1mM EDTA ...
-
bioRxiv - Neuroscience 2024Quote: Fresh-frozen brain samples were homogenized in 10x volume/weight of lysis buffer (1% NP40 (Thermo 85124) in ice cold PBS with protease and phosphatase inhibitors (Roche 04693132001 and 04906837001)) using a 3 mm bead (Qiagen 69997 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Crosslinked cells were lysed in 1 ml of Dig-Wash buffer (0.02% digitonin, 20 mM HEPES-potassium hydroxide buffer, pH 7.5, 150 mM sodium chloride, 0.5 mM spermidine, 1 Roche cOmplete EDTA-free tablet (11873580001) per 50 ml buffer and 0.1% BSA ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 19 hindguts were minced with a blade and incubated for 30 min at 37°C in a solution of Collagenase D (Roche, 1 mg/mL). After filtering in a 40 μM strainer and washing with BGJb ...
-
bioRxiv - Genetics 2024Quote: ... Nuclei were extracted by resuspending in 100 μL nuclei extraction buffer per 1-2.5 M cells (20 mM HEPES pH 7.5, 10 mM NaCl, 0.5 mM spermidine, 0.1% BSA, 0.1% NP-40, and 1 tablet Roche mini protease inhibitor per 10-15 mL) and incubating for 10 minutes on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell pellet was resuspended in 700 uL of ice-cold isotonic buffer (20 mM HEPES, pH 7.4, 250 mM sucrose and 1 mM EDTA) supplemented with EDTA-free protease (Roche, cOmplete EDTA-free, 05056489001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Biophysics 2021Quote: ... the 12-base 5’ overhang on each end of genomic DNA from bacteriophage λ (48,502 bp; Roche) was filled in with a mixture of natural and biotinylated nucleotides by the exonuclease-deficient DNA polymerase I Klenow fragment (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Immunology 2021Quote: ... All primary and secondary antibodies were diluted in 5% (v/v) western blotting reagent (Roche, Basel, Switzerland). After washing for 3 times in TBS-T ...
-
bioRxiv - Biochemistry 2021Quote: ... the presynaptic filament was formed by incubating 5 μl of streptavidin-coated magnetic resin (Roche Molecular Biochemicals) with 5’-biotinylated 80-mer ssDNA oligonucleotide (5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... for 5 minutes and cells were washed in cold PBS supplied with protease inhibitor cocktail (11873580001, Roche). Cells were stored as dry cell pellet at -80°C until further processed ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked in 5% skimmed milk and probed with anti-HA (Roche anti-HA-HRP 3F10), anti-Myc mouse monoclonal antibodies (Roche ...
-
bioRxiv - Immunology 2022Quote: ... 0.5% Na-deoxycholate) supplemented with 5 mM diisopropylfluorophosphate (DFP) in addition to the protease inhibitor cocktail (Roche). Cell scrapper was used to ensure optimal recovery of cell lysate ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 μL of the enriched phage pools (50 μL reactions) and a high-fidelity phusion polymerase (Roche) were used for the PCR reaction ...
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM EDTA, 0.10% NP40, 0.5 mM sodium orthovanadate, 0.5 mM NaF, protease inhibitor cocktail from Roche) and reduced in the presence of β-mercaptoethanol by boiling at 95°C for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... supplemented with Complete Mini EDTA-free Protease inhibitor tablets (46548400, Roche, ½ tablet per 5 mL lysis buffer) and phosphatase inhibitors (CA80501-130 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR mix consisted of 5 μL 2X LightCycler® 480 Probes Master (Roche, Cat. No. 04707494001), 1 μL MDA product ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by resuspension in 1 volume of Buffer C (5 mM Hepes pH 7.9, 26% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1xPIC (Roche) and 0.5 mM DTT ...
-
bioRxiv - Developmental Biology 2021Quote: ... they were incubated for 1 hour in blocking solution (Tris 0.1M pH 7.5, NaCl 150mM, Tween-20 0.1% and 5% blocking reagent Roche) and then with POD-conjugated anti-FITC antibody (11426346910 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1% NP-40 and 5 mM beta-mercaptoethanol) supplemented with Complete EDTA-free Protease Inhibitor Cocktail (Roche). The suspension was flash frozen in droplets ...
-
bioRxiv - Microbiology 2023Quote: ... D311A 5’-ATA ATC CCA TTT GGC GAC GTC AAT G) using KAPA HiFi HotStart ReadyMix (Roche). Homozygous KI was confirmed by Sanger sequencing after amplification using primer SAM_Seq_Ex16_FW (5’-CAT GAA GGC TCT TCC TGC GTA A ...
-
bioRxiv - Cell Biology 2023Quote: ... or ELB buffer (250 mM NaCI, 5 mM EDTA, 50 mM HEPES, 0.1% Ipegal, Roche protease inhibitor) with sonication (Qsonica ...
-
bioRxiv - Genomics 2023Quote: ... Magnesium chloride was added to a final concentration of 5 mM and KAPA HiFi 2x ReadyMix (Roche) was used ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated hepatocytes were seeded at a density of 4-500,000 and 1,000,000 cells in rat tail collagen I (5 μg/cm2, Roche) pre-coated 6-well plates and T25 flasks ...
-
bioRxiv - Molecular Biology 2024Quote: ... MEFs were frozen in liquid nitrogen and stored at 80 °C or directly lysed with lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 0.5% NP40, 0.5% Triron-X100, 5% glycerol, 1x Roche Complete EDTA free inhibitor cocktail ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were soaked in blocking solution (5% sterile horse serum, 0.5% Roche western blocking reagent in TNTx) for two hours at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... 50 mM Tris-HCl, pH 7.5; 5 mM EDTA; 0.5% Igepal-CA630; 1.0% Triton X-100; protease inhibitors [Roche]) and debris was removed by centrifugation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets were resuspended in PBS buffer supplemented with 5 mM imidazole and protease inhibitors (cOmplete, Roche). Cells were lysed by sonication and incubated at 80°C in a water bath for 10 min with sporadic manual agitation ...